Gene detail

Detail information of GWHGAAZE024046

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007019028.1	3.16548E-95	ChaC-like family protein isoform 1 [Theobroma cacao]
COG	YP_003898319.1	3E-33	cation transporter ChaC
trEMBL	tr\|A0A061FH77\|A0A061FH77_THECC	1E-95	ChaC-like family protein isoform 1 {ECO:0000313\|EMBL:EOY16253.1}
TAIR10	AT1G44790.1	8E-64	ChaC-like family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	33882131	33892577	+
GWHAAZE00000007	mRNA	33882131	33892577	+
GWHAAZE00000007	exon	33882131	33882239	+
GWHAAZE00000007	exon	33882995	33883065	+
GWHAAZE00000007	exon	33889470	33889526	+
GWHAAZE00000007	exon	33889673	33889713	+
GWHAAZE00000007	exon	33889799	33889870	+
GWHAAZE00000007	exon	33892066	33892145	+
GWHAAZE00000007	exon	33892489	33892577	+
GWHAAZE00000007	CDS	33882131	33882239	+
GWHAAZE00000007	CDS	33882995	33883065	+
GWHAAZE00000007	CDS	33889470	33889526	+
GWHAAZE00000007	CDS	33889673	33889713	+
GWHAAZE00000007	CDS	33889799	33889870	+
GWHAAZE00000007	CDS	33892066	33892145	+
GWHAAZE00000007	CDS	33892489	33892577	+

Transcript Sequence
>GWHTAAZE024080 ATGGTGATGTGGGTATTTGGATATGGGTCCCTAATTTGGAAACCAGGCTTTAATTACGATGATCGCCTTGTGGGTTTCATCAAAGATTACCGCCGTGTCTTCTACCAAGGTAGTACAGACCATAGAGGGACCCCAGAATATCCAGGAAGAACAGTCACATTGGAGCCTGCAGAGGGGGAGCTTCTAGAGGTGAGGGAGAAGCAATATGACCAAAAGGCTTATGTTGATTTCTTCACTGAGCCTTCAGCTTCAACACCAGCTGTTTCTGGAGTAATGGTATATATAGCATCTGCGGATAAGAAGACCAATCCAAACTACTTGGGCCCTGCATCACTTGAAGAGATTGCCGAGCAAATTGTTCACGCAGAAGGACCATCGGGACCAAACAGAGAGTACCTTTTCAAACTCGAAAACGCACTGCTTCACTTGGATTCTGTAGGACGCGAAGACAAACATGTATTGAGCATTGCAAAAGAAGTGAGGCGCATCCTTTCAGAGAAAGAACAGCCCGCTTCATGA

Network for GWHGAAZE024046

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04752.13	ChaC	3	59	4.00E-24
PF04752.13	ChaC	60	162	4.40E-18

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K22596	GGCT	Metabolic pathways	map01100
K22596	GGCT	Glutathione metabolism	map00480

Gene Ontology

GO term	Ontology	Name
GO:0006751	biological_process	glutathione catabolic process
GO:0003839	molecular_function	gamma-glutamylcyclotransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	32.416
	SRR3591706	second leaf	25.716
	SRR3591707	mature leaf	19.139
	SRR3591708	Shoot apex	34.289
	SRR3591709	Stem	27.800
	SRR3591710	White floral bud	54.841
	SRR3591711	White flower	50.812
	SRR3591712	Green floral bud	45.368
	SRR3591713	Yellow flower	84.668
SRP173429	SRR8316895	Juvenile bud stage	33.460
	SRR8316896	Juvenile bud stage	44.154
	SRR8316897	Juvenile bud stage	18.202
	SRR8316894	Third green stage	16.016
	SRR8316900	Third green stage	55.885
	SRR8316901	Third green stage	56.108
	SRR8316898	Complete white stage	19.117
	SRR8316899	Complete white stage	51.059
	SRR8316903	Complete white stage	24.450
	SRR8316902	Silver flowering stage	13.108
	SRR8316904	Silver flowering stage	21.526
	SRR8316905	Silver flowering stage	10.090
	SRR8316906	Gold flowering stage	41.447
	SRR8316907	Gold flowering stage	39.250
	SRR8316908	Gold flowering stage	42.224
SRP132670	SRR6706286	Control	49.459
	SRR6706287	Light intensity 50%	54.797
	SRR6706288	Light intensity 20%	60.209
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	45.237
	CNS0095593	Slightly white alabastrum(diploid) 2	42.526
	CNS0095594	Slightly white alabastrum(diploid) 3	43.904
	CNS0095595	Whole white alabastrum(diploid) 2	43.188
	CNS0095596	Whole white alabastrum(diploid) 3	47.424
	CNS0095597	Whole white alabastrum(diploid) 4	45.076
	CNS0095598	Silvery flower (diploied) 1	37.783
	CNS0095599	Silvery flower (diploied) 2	35.294
	CNS0095600	Silvery flower (diploied) 3	35.979
	CNS0095601	Golden flower (diploid) 1	38.277
	CNS0095602	Golden flower (diploid) 2	34.325
	CNS0095603	Golden flower (diploid) 3	34.746
	CNS0095604	Slightly white alabastrum(tetraploid) 1	49.655
	CNS0095605	Slightly white alabastrum(tetraploid) 2	53.998
	CNS0095606	Slightly white alabastrum(tetraploid) 3	47.178
	CNS0095607	Whole white alabastrum(tetraploid) 1	50.170
	CNS0095608	Whole white alabastrum(tetraploid) 2	40.172
	CNS0095609	Whole white alabastrum(tetraploid) 3	54.062
	CNS0095610	Silvery flower (tetraploid) 1	35.447
	CNS0095611	Silvery flower (tetraploid) 2	29.619
	CNS0095612	Silvery flower (tetraploid) 3	36.190
	CNS0095613	Golden flower (tetraploid) 1	29.194
	CNS0095614	Golden flower (tetraploid) 2	28.901
	CNS0095615	Golden flower (tetraploid) 3	24.698
CRA001975	CRR073297	Stem 1	40.718
	CRR073298	Stem 2	45.168
	CRR073299	Stem 3	43.291
	CRR073300	Leaf 1	41.001
	CRR073301	Leaf 2	40.910
	CRR073302	Leaf 3	46.738
	CRR073303	Juvenile bud 1	38.439
	CRR073304	Juvenile bud 2	39.248
	CRR073305	Juvenile bud 3	20.259
	CRR073306	Third green 1	20.953
	CRR073307	Third green 2	20.597
	CRR073308	Third green 3	20.756
	CRR073309	Second white 1	17.380
	CRR073310	Second white 2	26.862
	CRR073311	Second white 3	19.756
	CRR073312	Silver flowering 1	21.839
	CRR073313	Silver flowering 2	17.649
	CRR073314	Silver flowering 3	28.708
	CRR073315	Gold flowering 1	19.383
	CRR073316	Gold flowering 2	22.553
	CRR073317	Gold flowering 3	13.404
	CRR073318	Tawny withering 1	30.863
	CRR073319	Tawny withering 2	38.540
	CRR073320	Tawny withering 3	25.137