Gene detail

Detail information of GWHGAAZE024074

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010263184.1	5.04399E-75	PREDICTED: 50S ribosomal protein HLP, mitochondrial isoform X1 [Nelumbo nucifera]
COG	YP_003818451.1	4E-43	50S ribosomal protein L14
Swissprot	tr\|Q93Z17\|HLP_ARATH	4E-65	50S ribosomal protein HLP, mitochondrial (Precursor)
trEMBL	tr\|A0A068V846\|A0A068V846_COFCA	2E-74	Coffea canephora DH200=94 genomic scaffold, scaffold_137 {ECO:0000313\|EMBL:CDP16811.1}
TAIR10	AT5G46160.1	7E-41	Ribosomal protein L14p/L23e family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	34351715	34352068	+
GWHAAZE00000007	mRNA	34351715	34352068	+
GWHAAZE00000007	exon	34351715	34352068	+
GWHAAZE00000007	CDS	34351715	34352068	+

Transcript Sequence
>GWHTAAZE024108 ATGAGGACCAACCTCAAGGTGGTGGACAACTCTGGGGCAAAGCGGGTAATGTGCATACAAGCATTGAAGGGAAAGAAAGGGGCGAGACTAGGGGACACGATAGTTGCGTCAGTAAAGGAAGCCCAACCGGGCGGAAAAGTGAAGAAAGGAGCTGTCGTCTATGGGGTCGTTGTGCGGGCAGCCATGCAACGGGGCCGTTGCGATGGTAGTGAGGTAAAGTTTGATGATAATGCTGTGGTGCTTGTCAACAAGCAAGGCGAGCCGATCGGAACTAGAGTATTTGGGCCGGTCCCTCATGAGCTAAGGAAGAAAAAACATGTCAAGATTCTTAGTCTTGCTGAGCATATTGCCTGA

Network for GWHGAAZE024074

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00238.20	Ribosomal_L14	1	116	1.10E-48

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02874	RP-L14, MRPL14, rplN	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0015934	cellular_component	large ribosomal subunit
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	58.170
	SRR3591706	second leaf	42.578
	SRR3591707	mature leaf	52.190
	SRR3591708	Shoot apex	67.217
	SRR3591709	Stem	61.862
	SRR3591710	White floral bud	56.105
	SRR3591711	White flower	75.032
	SRR3591712	Green floral bud	84.953
	SRR3591713	Yellow flower	93.393
SRP173429	SRR8316895	Juvenile bud stage	58.650
	SRR8316896	Juvenile bud stage	85.145
	SRR8316897	Juvenile bud stage	35.151
	SRR8316894	Third green stage	33.256
	SRR8316900	Third green stage	94.872
	SRR8316901	Third green stage	106.373
	SRR8316898	Complete white stage	40.576
	SRR8316899	Complete white stage	113.456
	SRR8316903	Complete white stage	44.938
	SRR8316902	Silver flowering stage	39.651
	SRR8316904	Silver flowering stage	36.883
	SRR8316905	Silver flowering stage	20.621
	SRR8316906	Gold flowering stage	93.121
	SRR8316907	Gold flowering stage	92.094
	SRR8316908	Gold flowering stage	90.832
SRP132670	SRR6706286	Control	108.864
	SRR6706287	Light intensity 50%	108.154
	SRR6706288	Light intensity 20%	119.349
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	84.699
	CNS0095593	Slightly white alabastrum(diploid) 2	73.725
	CNS0095594	Slightly white alabastrum(diploid) 3	83.422
	CNS0095595	Whole white alabastrum(diploid) 2	79.233
	CNS0095596	Whole white alabastrum(diploid) 3	83.614
	CNS0095597	Whole white alabastrum(diploid) 4	66.269
	CNS0095598	Silvery flower (diploied) 1	72.556
	CNS0095599	Silvery flower (diploied) 2	68.323
	CNS0095600	Silvery flower (diploied) 3	64.547
	CNS0095601	Golden flower (diploid) 1	87.342
	CNS0095602	Golden flower (diploid) 2	67.951
	CNS0095603	Golden flower (diploid) 3	66.236
	CNS0095604	Slightly white alabastrum(tetraploid) 1	81.793
	CNS0095605	Slightly white alabastrum(tetraploid) 2	75.215
	CNS0095606	Slightly white alabastrum(tetraploid) 3	78.319
	CNS0095607	Whole white alabastrum(tetraploid) 1	64.117
	CNS0095608	Whole white alabastrum(tetraploid) 2	66.357
	CNS0095609	Whole white alabastrum(tetraploid) 3	88.628
	CNS0095610	Silvery flower (tetraploid) 1	91.619
	CNS0095611	Silvery flower (tetraploid) 2	83.477
	CNS0095612	Silvery flower (tetraploid) 3	56.297
	CNS0095613	Golden flower (tetraploid) 1	95.444
	CNS0095614	Golden flower (tetraploid) 2	106.186
	CNS0095615	Golden flower (tetraploid) 3	69.899
CRA001975	CRR073297	Stem 1	77.962
	CRR073298	Stem 2	74.122
	CRR073299	Stem 3	76.028
	CRR073300	Leaf 1	84.243
	CRR073301	Leaf 2	103.762
	CRR073302	Leaf 3	89.903
	CRR073303	Juvenile bud 1	78.556
	CRR073304	Juvenile bud 2	78.086
	CRR073305	Juvenile bud 3	60.290
	CRR073306	Third green 1	21.486
	CRR073307	Third green 2	32.696
	CRR073308	Third green 3	29.147
	CRR073309	Second white 1	46.070
	CRR073310	Second white 2	48.194
	CRR073311	Second white 3	33.998
	CRR073312	Silver flowering 1	42.213
	CRR073313	Silver flowering 2	40.762
	CRR073314	Silver flowering 3	39.417
	CRR073315	Gold flowering 1	52.392
	CRR073316	Gold flowering 2	67.372
	CRR073317	Gold flowering 3	55.410
	CRR073318	Tawny withering 1	58.268
	CRR073319	Tawny withering 2	59.738
	CRR073320	Tawny withering 3	53.436