Gene detail

Detail information of GWHGAAZE024134

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008445775.1	4.54039E-38	PREDICTED: probable indole-3-pyruvate monooxygenase YUCCA11 [Cucumis melo]
Swissprot	tr\|Q9FVQ0\|YUC10_ARATH	8E-28	Probable indole-3-pyruvate monooxygenase YUCCA10
trEMBL	tr\|A0A067H7K6\|A0A067H7K6_CITSI	1E-37	Uncharacterized protein {ECO:0000313\|EMBL:KDO83561.1} (Fragment)
TAIR10	AT1G48910.1	3E-24	Flavin-containing monooxygenase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	35755925	35764292	+
GWHAAZE00000007	mRNA	35755925	35764292	+
GWHAAZE00000007	exon	35755925	35756041	+
GWHAAZE00000007	exon	35762607	35762839	+
GWHAAZE00000007	exon	35764136	35764292	+
GWHAAZE00000007	CDS	35755925	35756041	+
GWHAAZE00000007	CDS	35762607	35762839	+
GWHAAZE00000007	CDS	35764136	35764292	+

Transcript Sequence
>GWHTAAZE024168 ATGTACAAGAATGTCCACGCTGCCATTTGCGGGGATCCTTCCCCAAAAACATCTGAGAAGCAGCCACCAAAGGAGCACAAGACATTCAACCTTACGAAGCTAACATATGATGAAGACGTACATGTGTTGACTAAAGAAATGGTGCAATTTGGGATGTATTTATCAAAATATCTTCCATTGAAATTGGTGGATAATACAATGATTATACTTAGCAAATTGAAATATGGAGATGTAATTGATTATGGGCTTGAAAGGCCCACAAAAGGTTCGTTTTATCTCAAAAATATAACGGGCCGATCTCCTGTTATTGATGTAGGCACCATGGAAAAATCAAGGACGGAAGCATTCAGGATGATGGAAACCTTTTCAATGAAGATGGAATACCCAAACCATTGGAAAGGGGAAAATGGTCTGTATTGTGCTGGATTTTCCAAGGCTGGACTATTTGGAATTTCAAATGATGCGCAAAATATAGCTGATGATATCAAGAAGGCTTTGGGGGCATAG

Network for GWHGAAZE024134

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF14204.7	Ribosomal_L18_c	1	38	7.00E-05

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K11816	YUCCA	Metabolic pathways	map01100
K11816	YUCCA	Tryptophan metabolism	map00380

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.264
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.076
	SRR8316896	Juvenile bud stage	0.044
	SRR8316897	Juvenile bud stage	0.212
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.153
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.178
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.021
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.038
	SRR8316908	Gold flowering stage	0.140
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.243
	CNS0095593	Slightly white alabastrum(diploid) 2	0.197
	CNS0095594	Slightly white alabastrum(diploid) 3	0.228
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.006
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.165
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.294
	CNS0095603	Golden flower (diploid) 3	0.200
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.095
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.199
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.052
	CNS0095612	Silvery flower (tetraploid) 3	0.039
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.207
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.031
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.025
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000