Gene detail

Detail information of GWHGAAZE024151

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006858391.1	3.54895E-44	hypothetical protein AMTR_s00071p00016000 [Amborella trichopoda]
COG	YP_007047706.1	2E-33	thioredoxin
Swissprot	tr\|P48384\|TRXM_PEA	6E-40	Thioredoxin M-type, chloroplastic (Precursor)
trEMBL	tr\|U5DHB6\|U5DHB6_AMBTC	1E-44	Uncharacterized protein {ECO:0000313\|EMBL:ERN19858.1}
TAIR10	AT3G15360.1	6E-28	thioredoxin M-type 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	36256896	36257204	+
GWHAAZE00000007	mRNA	36256896	36257204	+
GWHAAZE00000007	exon	36256896	36257204	+
GWHAAZE00000007	CDS	36256896	36257204	+

Transcript Sequence
>GWHTAAZE024185 ACCGTGAATGTTTCTCCTGCAGTTGATGTGGTGACAGCATGTAGCTGGAATGATAGAGTCGTTGCAAGTGACGAGCCCGTGCTAGTCGAGTTCTGGGCCCCACAGTGCAGTCCTTGCGGGATGATTGAGCCAATCCTCAATGAACTGGCAAAAGAATATGCGGGGAAAATCCTTTGTTATAAGCTCAACACGGAGGATTGTCCCACCATAGCGTCACAATATGAAATAAAAAGCATACCAACGGTGGTGTTGTTCAAGGATGGAGAGAAGAAAGAGTTTGTTATTGGTGCTGTTCCAAAGTCTGCCCTT

Network for GWHGAAZE024151

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00085.21	Thioredoxin	9	103	8.60E-25

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03671	trxA	NOD-like receptor signaling pathway	map04621

Gene Ontology

GO term	Ontology	Name
GO:0045454	biological_process	cell redox homeostasis
GO:0006662	biological_process	glycerol ether metabolic process
GO:0015035	molecular_function	protein disulfide oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.398
	SRR3591706	second leaf	12.732
	SRR3591707	mature leaf	16.459
	SRR3591708	Shoot apex	3.462
	SRR3591709	Stem	0.881
	SRR3591710	White floral bud	0.860
	SRR3591711	White flower	1.289
	SRR3591712	Green floral bud	0.799
	SRR3591713	Yellow flower	0.156
SRP173429	SRR8316895	Juvenile bud stage	1.725
	SRR8316896	Juvenile bud stage	1.611
	SRR8316897	Juvenile bud stage	2.234
	SRR8316894	Third green stage	0.802
	SRR8316900	Third green stage	0.528
	SRR8316901	Third green stage	0.541
	SRR8316898	Complete white stage	0.146
	SRR8316899	Complete white stage	1.629
	SRR8316903	Complete white stage	0.758
	SRR8316902	Silver flowering stage	0.132
	SRR8316904	Silver flowering stage	0.291
	SRR8316905	Silver flowering stage	0.109
	SRR8316906	Gold flowering stage	0.734
	SRR8316907	Gold flowering stage	0.730
	SRR8316908	Gold flowering stage	0.148
SRP132670	SRR6706286	Control	1.433
	SRR6706287	Light intensity 50%	1.562
	SRR6706288	Light intensity 20%	0.667
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.523
	CNS0095593	Slightly white alabastrum(diploid) 2	1.498
	CNS0095594	Slightly white alabastrum(diploid) 3	0.156
	CNS0095595	Whole white alabastrum(diploid) 2	1.864
	CNS0095596	Whole white alabastrum(diploid) 3	0.550
	CNS0095597	Whole white alabastrum(diploid) 4	0.300
	CNS0095598	Silvery flower (diploied) 1	2.713
	CNS0095599	Silvery flower (diploied) 2	2.791
	CNS0095600	Silvery flower (diploied) 3	0.402
	CNS0095601	Golden flower (diploid) 1	1.541
	CNS0095602	Golden flower (diploid) 2	1.692
	CNS0095603	Golden flower (diploid) 3	1.473
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.906
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.824
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.188
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.954
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.242
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.398
	CNS0095610	Silvery flower (tetraploid) 1	0.283
	CNS0095611	Silvery flower (tetraploid) 2	0.816
	CNS0095612	Silvery flower (tetraploid) 3	0.453
	CNS0095613	Golden flower (tetraploid) 1	0.368
	CNS0095614	Golden flower (tetraploid) 2	0.912
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	5.912
	CRR073298	Stem 2	4.189
	CRR073299	Stem 3	8.799
	CRR073300	Leaf 1	0.914
	CRR073301	Leaf 2	1.104
	CRR073302	Leaf 3	2.204
	CRR073303	Juvenile bud 1	0.222
	CRR073304	Juvenile bud 2	0.049
	CRR073305	Juvenile bud 3	0.164
	CRR073306	Third green 1	0.204
	CRR073307	Third green 2	0.238
	CRR073308	Third green 3	0.244
	CRR073309	Second white 1	0.532
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.590
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	39.190
	CRR073316	Gold flowering 2	42.528
	CRR073317	Gold flowering 3	33.938
	CRR073318	Tawny withering 1	1.089
	CRR073319	Tawny withering 2	2.808
	CRR073320	Tawny withering 3	0.050