Gene detail

Detail information of GWHGAAZE024229

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AFK48674.1	4.24594E-64	unknown [Lotus japonicus]
Swissprot	tr\|Q96520\|PER12_ARATH	2E-50	Peroxidase 12 (Precursor)
trEMBL	tr\|I3T832\|I3T832_LOTJA	2E-64	Uncharacterized protein {ECO:0000313\|EMBL:AFK48674.1}
TAIR10	AT1G71695.1	1E-41	Peroxidase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	38103446	38104976	+
GWHAAZE00000007	mRNA	38103446	38104976	+
GWHAAZE00000007	exon	38103446	38103688	+
GWHAAZE00000007	exon	38104764	38104976	+
GWHAAZE00000007	CDS	38103446	38103688	+
GWHAAZE00000007	CDS	38104764	38104976	+

Transcript Sequence
>GWHTAAZE024263 ATGGCTTCTTTAAGCTCTTCACTGTTCATATGCTGCATTTTATTATTATTATTATTATCTTCTTCACACTTGTATGTTGTAGAGGCTCAAAGCCCACCTATAGTGGAAGGACTCTCCTGGGATTTTTATAAAACAACTTGCCCTAATTTGGAATCCATTATTAGAGAAGAGCTCCAAAGAGTGTTCGAGCAAGATATTGGCCAAGCTGCTGGCTTGCTTCGCCTCCATTTCCATGATTGCTTTGGATGCGATGCATCAGTGCTATTAGATGGATCGGCCAGTGGACCGGGTGAGCAGGAGGCCCCTCCAAACTTGACTCTTAGACCAGGGGCATTTAGGATTATTGACGATCTTCGTCGTCGTGCACAAGTAGAGTGTGGTAGGATTGTATCTTGCGCTGATATCGTTGCTCTCGCTGCCCGTGATGCAGTTTACTTGGTAAGTACCAATAGCTAA

Network for GWHGAAZE024229

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00141.24	peroxidase	55	146	1.90E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00430	E1.11.1.7	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Phenylpropanoid biosynthesis	map00940

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0006979	biological_process	response to oxidative stress
GO:0004601	molecular_function	peroxidase activity
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	14.276
	SRR3591706	second leaf	45.449
	SRR3591707	mature leaf	29.509
	SRR3591708	Shoot apex	26.231
	SRR3591709	Stem	2.842
	SRR3591710	White floral bud	6.756
	SRR3591711	White flower	1.890
	SRR3591712	Green floral bud	8.382
	SRR3591713	Yellow flower	0.327
SRP173429	SRR8316895	Juvenile bud stage	1.896
	SRR8316896	Juvenile bud stage	1.429
	SRR8316897	Juvenile bud stage	1.076
	SRR8316894	Third green stage	0.370
	SRR8316900	Third green stage	0.866
	SRR8316901	Third green stage	1.903
	SRR8316898	Complete white stage	0.711
	SRR8316899	Complete white stage	1.606
	SRR8316903	Complete white stage	0.892
	SRR8316902	Silver flowering stage	0.237
	SRR8316904	Silver flowering stage	1.500
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.018
	SRR8316907	Gold flowering stage	0.512
	SRR8316908	Gold flowering stage	0.189
SRP132670	SRR6706286	Control	9.039
	SRR6706287	Light intensity 50%	6.189
	SRR6706288	Light intensity 20%	4.941
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.875
	CNS0095593	Slightly white alabastrum(diploid) 2	1.329
	CNS0095594	Slightly white alabastrum(diploid) 3	0.583
	CNS0095595	Whole white alabastrum(diploid) 2	2.075
	CNS0095596	Whole white alabastrum(diploid) 3	1.744
	CNS0095597	Whole white alabastrum(diploid) 4	0.783
	CNS0095598	Silvery flower (diploied) 1	1.941
	CNS0095599	Silvery flower (diploied) 2	0.804
	CNS0095600	Silvery flower (diploied) 3	0.478
	CNS0095601	Golden flower (diploid) 1	0.362
	CNS0095602	Golden flower (diploid) 2	0.368
	CNS0095603	Golden flower (diploid) 3	0.290
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.652
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.168
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.467
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.524
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.085
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.896
	CNS0095610	Silvery flower (tetraploid) 1	0.082
	CNS0095611	Silvery flower (tetraploid) 2	0.663
	CNS0095612	Silvery flower (tetraploid) 3	1.268
	CNS0095613	Golden flower (tetraploid) 1	0.069
	CNS0095614	Golden flower (tetraploid) 2	0.496
	CNS0095615	Golden flower (tetraploid) 3	0.547
CRA001975	CRR073297	Stem 1	8.434
	CRR073298	Stem 2	7.252
	CRR073299	Stem 3	9.954
	CRR073300	Leaf 1	9.039
	CRR073301	Leaf 2	6.947
	CRR073302	Leaf 3	7.379
	CRR073303	Juvenile bud 1	6.270
	CRR073304	Juvenile bud 2	7.230
	CRR073305	Juvenile bud 3	7.721
	CRR073306	Third green 1	4.024
	CRR073307	Third green 2	1.252
	CRR073308	Third green 3	1.414
	CRR073309	Second white 1	0.231
	CRR073310	Second white 2	0.269
	CRR073311	Second white 3	0.186
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.365
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	21.267
	CRR073316	Gold flowering 2	25.227
	CRR073317	Gold flowering 3	32.778
	CRR073318	Tawny withering 1	1.352
	CRR073319	Tawny withering 2	0.108
	CRR073320	Tawny withering 3	1.669