Gene detail

Detail information of GWHGAAZE024230

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009586787.1	2.2891E-105	PREDICTED: peroxidase 12-like [Nicotiana tomentosiformis]
Swissprot	tr\|Q96520\|PER12_ARATH	1E-90	Peroxidase 12 (Precursor)
trEMBL	tr\|Q94IQ1\|Q94IQ1_TOBAC	9E-106	Peroxidase {ECO:0000313\|EMBL:AAK52084.1}
TAIR10	AT1G71695.1	5E-74	Peroxidase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	38108570	38109193	+
GWHAAZE00000007	mRNA	38108570	38109193	+
GWHAAZE00000007	exon	38108570	38109193	+
GWHAAZE00000007	CDS	38108570	38109193	+

Transcript Sequence
>GWHTAAZE024264 ATGCAGTCTGGAGGGCCTGATTACAACATTCCCTTAGGAAGACGTGATTCACTAAACTTTGCAACAGTTAACGAAACCCTTGCCAACCTTCCTCCACCAACATCTATTGCAACTGAGATTCTCAACTCTCTTGCCAACTTGAACTTCGACCCAACTGATGTAGTCGCCCTCTCCGGGGGTCACACTATTGGCATTGCCCACTGCATGTCCTTCATGCGTCGCTTGTACCCAAACCAAGACCCCACTATGGACAAGACCTTTGCCAACAACCTCATGGAAGTTTGCCCCCCTGGAAACACCACCAACACCACTGTCTTGGATATTCGATCACCAAACGTCTTTGATAACAAGTACTATGTCGATCTTATGAATCGACAGGGCCTCTTTACATCTGACCAAGACTTGTACACTTATAGGGGGACTAGAGGGATTGTTACAAGCTTTGCGGTTAATCAAACTCTTTTCTTTGAAAAGTTTGTTTTTGCAATGATTAAGATGGGGCAACTGAATGTGTCGACCGGGACGCAAGGAGAAATTCGTGGGAATTGTTCGGCTAGAAATTTGGGTATATCAACTACATTATCTATATTGGAAGAGGAGCAGAAGGGCCGATCGGAGTTTTGA

Network for GWHGAAZE024230

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00141.24	peroxidase	3	150	2.60E-37

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00430	E1.11.1.7	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Phenylpropanoid biosynthesis	map00940

Gene Ontology

GO term	Ontology	Name
GO:0006979	biological_process	response to oxidative stress
GO:0055114	biological_process	oxidation-reduction process
GO:0004601	molecular_function	peroxidase activity
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.182
	SRR3591706	second leaf	9.539
	SRR3591707	mature leaf	2.407
	SRR3591708	Shoot apex	1.175
	SRR3591709	Stem	0.504
	SRR3591710	White floral bud	1.227
	SRR3591711	White flower	0.172
	SRR3591712	Green floral bud	2.109
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.577
	SRR8316896	Juvenile bud stage	0.156
	SRR8316897	Juvenile bud stage	0.131
	SRR8316894	Third green stage	0.212
	SRR8316900	Third green stage	1.236
	SRR8316901	Third green stage	0.646
	SRR8316898	Complete white stage	0.250
	SRR8316899	Complete white stage	0.277
	SRR8316903	Complete white stage	0.348
	SRR8316902	Silver flowering stage	0.059
	SRR8316904	Silver flowering stage	0.055
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.313
	SRR8316907	Gold flowering stage	0.270
	SRR8316908	Gold flowering stage	0.154
SRP132670	SRR6706286	Control	3.710
	SRR6706287	Light intensity 50%	1.874
	SRR6706288	Light intensity 20%	0.949
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.229
	CNS0095593	Slightly white alabastrum(diploid) 2	0.635
	CNS0095594	Slightly white alabastrum(diploid) 3	0.181
	CNS0095595	Whole white alabastrum(diploid) 2	0.272
	CNS0095596	Whole white alabastrum(diploid) 3	0.620
	CNS0095597	Whole white alabastrum(diploid) 4	1.898
	CNS0095598	Silvery flower (diploied) 1	1.298
	CNS0095599	Silvery flower (diploied) 2	0.199
	CNS0095600	Silvery flower (diploied) 3	0.006
	CNS0095601	Golden flower (diploid) 1	0.192
	CNS0095602	Golden flower (diploid) 2	0.476
	CNS0095603	Golden flower (diploid) 3	0.373
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.414
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.211
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.244
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.489
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.130
	CNS0095610	Silvery flower (tetraploid) 1	0.027
	CNS0095611	Silvery flower (tetraploid) 2	0.244
	CNS0095612	Silvery flower (tetraploid) 3	0.143
	CNS0095613	Golden flower (tetraploid) 1	0.105
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.398
CRA001975	CRR073297	Stem 1	2.300
	CRR073298	Stem 2	1.542
	CRR073299	Stem 3	1.147
	CRR073300	Leaf 1	1.582
	CRR073301	Leaf 2	1.113
	CRR073302	Leaf 3	1.239
	CRR073303	Juvenile bud 1	0.657
	CRR073304	Juvenile bud 2	3.665
	CRR073305	Juvenile bud 3	1.026
	CRR073306	Third green 1	0.264
	CRR073307	Third green 2	0.243
	CRR073308	Third green 3	0.345
	CRR073309	Second white 1	0.210
	CRR073310	Second white 2	0.061
	CRR073311	Second white 3	0.203
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.323
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	8.980
	CRR073316	Gold flowering 2	8.433
	CRR073317	Gold flowering 3	13.362
	CRR073318	Tawny withering 1	0.714
	CRR073319	Tawny withering 2	0.563
	CRR073320	Tawny withering 3	0.763