Gene detail

Detail information of GWHGAAZE024231

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009586787.1	4.4734E-84	PREDICTED: peroxidase 12-like [Nicotiana tomentosiformis]
Swissprot	tr\|Q96520\|PER12_ARATH	9E-71	Peroxidase 12 (Precursor)
trEMBL	tr\|Q94IQ1\|Q94IQ1_TOBAC	2E-84	Peroxidase {ECO:0000313\|EMBL:AAK52084.1}
TAIR10	AT1G71695.1	9E-54	Peroxidase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	38150327	38154573	+
GWHAAZE00000007	mRNA	38150327	38154573	+
GWHAAZE00000007	exon	38150327	38150575	+
GWHAAZE00000007	exon	38151824	38152018	+
GWHAAZE00000007	exon	38154430	38154573	+
GWHAAZE00000007	CDS	38150327	38150575	+
GWHAAZE00000007	CDS	38151824	38152018	+
GWHAAZE00000007	CDS	38154430	38154573	+

Transcript Sequence
>GWHTAAZE024265 ATGGCTTCTTTAAGCTCTTCACTCTTGTTTTTCATATGCTGCATTTTATTATTATTATCTTCTTCACACTTGTATGTTGTAGAGGCTCAAAGCCCACCTATAGTGGAAGGACTCTCATGGGATTTTTATAAAACAACTTGCCCTAATTTGGAATCCATTATTAGAGAAGAGCTCCAAAAAGTGTTCGAGGAAGACATTGGCCAAGCTGCTGGCTTGCTTCGCCTCCATTTCCATGATTGCTTTGTTCAGGGATGCGATGCATCAGTGCTATTAGATGGATCAGCCAGTGAACCGGGTGAGCAAGAGGCCCCTCCAAACTTGACTCTTAGTCCAAGAGCATTGAGGATCATTGATGATCTTCGTCGTCGTGCACAAGAAGAGTGTGGTAGGATTGTCTCTTGTGCTGATATCACCGCTATCGCTGCCCGTGATGCAGTTTACTTGTCTGGAGGACCTAATTACAGCATTCCCTTGGGAAGACGTGACTCACTAACCTTTGCAACAAGAAATGAAACCCTTGCCAACATTCCTCCACCAACAGCAACGCGCAGCAGTAGTTCTCACCTTGTTCGCCAACAAAAGCTTTGA

Network for GWHGAAZE024231

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00141.24	peroxidase	55	182	9.30E-35

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00430	E1.11.1.7	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Phenylpropanoid biosynthesis	map00940

Gene Ontology

GO term	Ontology	Name
GO:0006979	biological_process	response to oxidative stress
GO:0055114	biological_process	oxidation-reduction process
GO:0004601	molecular_function	peroxidase activity
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	7.245
	SRR3591706	second leaf	18.528
	SRR3591707	mature leaf	11.601
	SRR3591708	Shoot apex	89.662
	SRR3591709	Stem	0.915
	SRR3591710	White floral bud	11.781
	SRR3591711	White flower	19.970
	SRR3591712	Green floral bud	8.886
	SRR3591713	Yellow flower	2.181
SRP173429	SRR8316895	Juvenile bud stage	8.037
	SRR8316896	Juvenile bud stage	5.823
	SRR8316897	Juvenile bud stage	3.721
	SRR8316894	Third green stage	1.399
	SRR8316900	Third green stage	3.152
	SRR8316901	Third green stage	5.742
	SRR8316898	Complete white stage	4.110
	SRR8316899	Complete white stage	6.277
	SRR8316903	Complete white stage	3.213
	SRR8316902	Silver flowering stage	1.143
	SRR8316904	Silver flowering stage	2.481
	SRR8316905	Silver flowering stage	1.536
	SRR8316906	Gold flowering stage	2.211
	SRR8316907	Gold flowering stage	4.406
	SRR8316908	Gold flowering stage	5.361
SRP132670	SRR6706286	Control	40.639
	SRR6706287	Light intensity 50%	25.790
	SRR6706288	Light intensity 20%	18.206
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.179
	CNS0095593	Slightly white alabastrum(diploid) 2	4.092
	CNS0095594	Slightly white alabastrum(diploid) 3	4.927
	CNS0095595	Whole white alabastrum(diploid) 2	3.241
	CNS0095596	Whole white alabastrum(diploid) 3	0.669
	CNS0095597	Whole white alabastrum(diploid) 4	2.133
	CNS0095598	Silvery flower (diploied) 1	11.038
	CNS0095599	Silvery flower (diploied) 2	4.045
	CNS0095600	Silvery flower (diploied) 3	3.498
	CNS0095601	Golden flower (diploid) 1	2.893
	CNS0095602	Golden flower (diploid) 2	3.823
	CNS0095603	Golden flower (diploid) 3	2.622
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.414
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.425
	CNS0095606	Slightly white alabastrum(tetraploid) 3	14.381
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.275
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.016
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.354
	CNS0095610	Silvery flower (tetraploid) 1	4.021
	CNS0095611	Silvery flower (tetraploid) 2	15.408
	CNS0095612	Silvery flower (tetraploid) 3	15.779
	CNS0095613	Golden flower (tetraploid) 1	1.001
	CNS0095614	Golden flower (tetraploid) 2	0.467
	CNS0095615	Golden flower (tetraploid) 3	18.882
CRA001975	CRR073297	Stem 1	49.004
	CRR073298	Stem 2	39.868
	CRR073299	Stem 3	89.804
	CRR073300	Leaf 1	11.488
	CRR073301	Leaf 2	11.349
	CRR073302	Leaf 3	15.482
	CRR073303	Juvenile bud 1	5.638
	CRR073304	Juvenile bud 2	15.868
	CRR073305	Juvenile bud 3	14.309
	CRR073306	Third green 1	5.162
	CRR073307	Third green 2	3.195
	CRR073308	Third green 3	6.511
	CRR073309	Second white 1	6.237
	CRR073310	Second white 2	1.529
	CRR073311	Second white 3	2.016
	CRR073312	Silver flowering 1	1.245
	CRR073313	Silver flowering 2	0.123
	CRR073314	Silver flowering 3	1.247
	CRR073315	Gold flowering 1	2.541
	CRR073316	Gold flowering 2	2.332
	CRR073317	Gold flowering 3	5.269
	CRR073318	Tawny withering 1	0.362
	CRR073319	Tawny withering 2	0.094
	CRR073320	Tawny withering 3	0.236