Gene detail

Detail information of GWHGAAZE024253

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006434548.1	3.64047E-26	hypothetical protein CICLE_v10003530mg [Citrus clementina]
Swissprot	tr\|P42731\|PABP2_ARATH	1E-21	Polyadenylate-binding protein 2
trEMBL	tr\|V4SJ94\|V4SJ94_9ROSI	1E-26	Uncharacterized protein {ECO:0000313\|EMBL:ESR47788.1}
TAIR10	AT4G34110.1	3E-18	poly(A) binding protein 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	38630365	38630643	-
GWHAAZE00000007	mRNA	38630365	38630643	-
GWHAAZE00000007	exon	38630365	38630643	-
GWHAAZE00000007	CDS	38630365	38630643	-

Transcript Sequence
>GWHTAAZE024287 ATGGCGACGGCGGTTCAGGCTCCGTCAGCGATTCCTCAGGCGACTCCACCGCCGACTCCTCCCTCGTCTGCTTCCGGAGTGCCAGGATTCGGCAATGTATCACTCTACGTCGGCGATCTCGATTCCACCGTCAACGACAGCCAACTCTACGATCTCTTCAACCAGGTCGCTCAAGTCGTCTCCGTGAGGGTTTGTAGGGATCAGACTAGGCGAACTTCTCTAGGTTATGCCTATGTCAATTTCAGTAATCCTCAAGACGGTCAGCTTCTCCCTCCTTGA

Network for GWHGAAZE024253

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00076.23	RRM_1	35	86	2.00E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13126	PABPC	RNA transport	map03013
		mRNA surveillance pathway	map03015
		RNA degradation	map03018

Gene Ontology

GO term	Ontology	Name
GO:0003676	molecular_function	nucleic acid binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	16.430
	SRR3591706	second leaf	4.372
	SRR3591707	mature leaf	1.380
	SRR3591708	Shoot apex	7.686
	SRR3591709	Stem	7.281
	SRR3591710	White floral bud	4.312
	SRR3591711	White flower	2.571
	SRR3591712	Green floral bud	6.635
	SRR3591713	Yellow flower	3.835
SRP173429	SRR8316895	Juvenile bud stage	9.977
	SRR8316896	Juvenile bud stage	14.206
	SRR8316897	Juvenile bud stage	4.725
	SRR8316894	Third green stage	2.877
	SRR8316900	Third green stage	4.920
	SRR8316901	Third green stage	4.390
	SRR8316898	Complete white stage	0.454
	SRR8316899	Complete white stage	1.622
	SRR8316903	Complete white stage	2.053
	SRR8316902	Silver flowering stage	0.230
	SRR8316904	Silver flowering stage	0.093
	SRR8316905	Silver flowering stage	0.172
	SRR8316906	Gold flowering stage	0.680
	SRR8316907	Gold flowering stage	0.675
	SRR8316908	Gold flowering stage	1.066
SRP132670	SRR6706286	Control	6.934
	SRR6706287	Light intensity 50%	5.688
	SRR6706288	Light intensity 20%	7.840
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.040
	CNS0095593	Slightly white alabastrum(diploid) 2	1.702
	CNS0095594	Slightly white alabastrum(diploid) 3	5.964
	CNS0095595	Whole white alabastrum(diploid) 2	1.476
	CNS0095596	Whole white alabastrum(diploid) 3	1.102
	CNS0095597	Whole white alabastrum(diploid) 4	1.281
	CNS0095598	Silvery flower (diploied) 1	0.365
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.542
	CNS0095601	Golden flower (diploid) 1	0.257
	CNS0095602	Golden flower (diploid) 2	2.007
	CNS0095603	Golden flower (diploid) 3	1.090
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.387
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.221
	CNS0095606	Slightly white alabastrum(tetraploid) 3	11.315
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.046
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.581
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.821
	CNS0095610	Silvery flower (tetraploid) 1	0.764
	CNS0095611	Silvery flower (tetraploid) 2	0.479
	CNS0095612	Silvery flower (tetraploid) 3	2.721
	CNS0095613	Golden flower (tetraploid) 1	0.279
	CNS0095614	Golden flower (tetraploid) 2	0.652
	CNS0095615	Golden flower (tetraploid) 3	0.882
CRA001975	CRR073297	Stem 1	10.855
	CRR073298	Stem 2	9.831
	CRR073299	Stem 3	8.920
	CRR073300	Leaf 1	4.747
	CRR073301	Leaf 2	3.575
	CRR073302	Leaf 3	1.893
	CRR073303	Juvenile bud 1	3.386
	CRR073304	Juvenile bud 2	5.241
	CRR073305	Juvenile bud 3	5.285
	CRR073306	Third green 1	0.511
	CRR073307	Third green 2	0.299
	CRR073308	Third green 3	0.383
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.032
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.824
	CRR073316	Gold flowering 2	1.737
	CRR073317	Gold flowering 3	1.151
	CRR073318	Tawny withering 1	3.961
	CRR073319	Tawny withering 2	5.189
	CRR073320	Tawny withering 3	6.002