Gene detail

Detail information of GWHGAAZE024289

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004138165.1	6.12044E-77	PREDICTED: 60S ribosomal protein L34-like [Cucumis sativus]
COG	YP_006362913.1	0.00000001	50S ribosomal protein L34e
Swissprot	tr\|P41098\|RL34_TOBAC	7E-78	60S ribosomal protein L34
trEMBL	tr\|A0A0A0LK03\|A0A0A0LK03_CUCSA	2E-77	Uncharacterized protein {ECO:0000313\|EMBL:KGN62245.1}
TAIR10	AT1G26880.1	7E-48	Ribosomal protein L34e superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	39513849	39517930	+
GWHAAZE00000007	mRNA	39513849	39517930	+
GWHAAZE00000007	exon	39513849	39513941	+
GWHAAZE00000007	exon	39514556	39514635	+
GWHAAZE00000007	exon	39517511	39517620	+
GWHAAZE00000007	exon	39517837	39517930	+
GWHAAZE00000007	five_prime_UTR	39513849	39513862	+
GWHAAZE00000007	CDS	39513863	39513941	+
GWHAAZE00000007	CDS	39514556	39514635	+
GWHAAZE00000007	CDS	39517511	39517620	+
GWHAAZE00000007	CDS	39517837	39517930	+

Transcript Sequence
>GWHTAAZE024323 TTGAAGCACAAAAAATGGTGCAAAGGTTAACATATCGTAAGAGGCATAGTTATGCCACCAAATCCAACCAGAAGAGGGTCGTCAAAACCCCCGGTGGGAAGCTAGTTTACCAAACTACCAAGAAGAGAGCTAGCGGACCTAAATGTCCCGTCACTGGGAAGAGAATCCAAGGGATTCCCCATTTGAGACCTGCTGAATACAAGAGGTCCAGATTGTCTAGGAACCGGAGGACAGTCAATCGTGCCTACGGTGGTGTATTGTCTGGCAGTGCTGTTAGGGAGAGGATCATCAGAGCATTCCTGGTGGAAGAGCAGAAAATTGTGAAAAAGGTTCTGAAGATCCAAAAGGCAAAGGAAAAGGTAGCCTCAAAGAGTTGA

Network for GWHGAAZE024289

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01199.19	Ribosomal_L34e	1	96	6.60E-39

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02915	RP-L34e, RPL34	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	250.050
	SRR3591706	second leaf	109.953
	SRR3591707	mature leaf	49.155
	SRR3591708	Shoot apex	334.910
	SRR3591709	Stem	123.965
	SRR3591710	White floral bud	139.110
	SRR3591711	White flower	127.468
	SRR3591712	Green floral bud	208.257
	SRR3591713	Yellow flower	95.345
SRP173429	SRR8316895	Juvenile bud stage	127.063
	SRR8316896	Juvenile bud stage	180.521
	SRR8316897	Juvenile bud stage	74.764
	SRR8316894	Third green stage	81.974
	SRR8316900	Third green stage	232.646
	SRR8316901	Third green stage	228.462
	SRR8316898	Complete white stage	53.821
	SRR8316899	Complete white stage	202.287
	SRR8316903	Complete white stage	110.171
	SRR8316902	Silver flowering stage	61.646
	SRR8316904	Silver flowering stage	60.363
	SRR8316905	Silver flowering stage	37.565
	SRR8316906	Gold flowering stage	113.741
	SRR8316907	Gold flowering stage	106.971
	SRR8316908	Gold flowering stage	105.714
SRP132670	SRR6706286	Control	316.203
	SRR6706287	Light intensity 50%	321.169
	SRR6706288	Light intensity 20%	349.411
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	191.680
	CNS0095593	Slightly white alabastrum(diploid) 2	205.972
	CNS0095594	Slightly white alabastrum(diploid) 3	198.602
	CNS0095595	Whole white alabastrum(diploid) 2	153.085
	CNS0095596	Whole white alabastrum(diploid) 3	159.167
	CNS0095597	Whole white alabastrum(diploid) 4	113.395
	CNS0095598	Silvery flower (diploied) 1	102.551
	CNS0095599	Silvery flower (diploied) 2	87.927
	CNS0095600	Silvery flower (diploied) 3	87.289
	CNS0095601	Golden flower (diploid) 1	84.848
	CNS0095602	Golden flower (diploid) 2	73.940
	CNS0095603	Golden flower (diploid) 3	69.527
	CNS0095604	Slightly white alabastrum(tetraploid) 1	164.477
	CNS0095605	Slightly white alabastrum(tetraploid) 2	155.997
	CNS0095606	Slightly white alabastrum(tetraploid) 3	240.203
	CNS0095607	Whole white alabastrum(tetraploid) 1	88.732
	CNS0095608	Whole white alabastrum(tetraploid) 2	82.356
	CNS0095609	Whole white alabastrum(tetraploid) 3	168.635
	CNS0095610	Silvery flower (tetraploid) 1	51.924
	CNS0095611	Silvery flower (tetraploid) 2	52.527
	CNS0095612	Silvery flower (tetraploid) 3	49.181
	CNS0095613	Golden flower (tetraploid) 1	44.624
	CNS0095614	Golden flower (tetraploid) 2	58.159
	CNS0095615	Golden flower (tetraploid) 3	29.238
CRA001975	CRR073297	Stem 1	246.762
	CRR073298	Stem 2	278.695
	CRR073299	Stem 3	271.090
	CRR073300	Leaf 1	271.890
	CRR073301	Leaf 2	311.144
	CRR073302	Leaf 3	297.811
	CRR073303	Juvenile bud 1	208.803
	CRR073304	Juvenile bud 2	161.215
	CRR073305	Juvenile bud 3	116.095
	CRR073306	Third green 1	43.358
	CRR073307	Third green 2	58.250
	CRR073308	Third green 3	67.612
	CRR073309	Second white 1	22.458
	CRR073310	Second white 2	42.196
	CRR073311	Second white 3	27.559
	CRR073312	Silver flowering 1	31.882
	CRR073313	Silver flowering 2	24.167
	CRR073314	Silver flowering 3	27.041
	CRR073315	Gold flowering 1	83.667
	CRR073316	Gold flowering 2	84.713
	CRR073317	Gold flowering 3	57.813
	CRR073318	Tawny withering 1	266.215
	CRR073319	Tawny withering 2	190.457
	CRR073320	Tawny withering 3	275.779