Gene detail

Detail information of GWHGAAZE024305

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO72559.1	1.09103E-88	hypothetical protein CISIN_1g041877mg [Citrus sinensis]
Swissprot	tr\|Q8LC03\|ATB13_ARATH	1E-69	Homeobox-leucine zipper protein ATHB-13
trEMBL	tr\|A0A067FYT8\|A0A067FYT8_CITSI	4E-89	Uncharacterized protein {ECO:0000313\|EMBL:KDO72559.1}
TAIR10	AT1G69780.1	2E-57	Homeobox-leucine zipper protein family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	39760064	39762148	+
GWHAAZE00000007	mRNA	39760064	39762148	+
GWHAAZE00000007	exon	39760064	39760435	+
GWHAAZE00000007	exon	39761873	39762148	+
GWHAAZE00000007	CDS	39760064	39760435	+
GWHAAZE00000007	CDS	39761873	39762148	+

Transcript Sequence
>GWHTAAZE024339 ATGTTGATGAGGAGATCGATGTCGTTTTCGGGGATTAATGAGAGGTGTGATCATGAAGTGAGGGGAGATGATGACATGTCTGATGATGGATCACAGCTAGGGGAGAAGAAGAGGAGGCTGAATTTGGAGCAAGTGAAGGCACTTGAGAGGAGCTTTGAGTTGGGTAACAAGCTTGAGCCAGAGAGGAAAGTCCAGTTGGCTAGGGCATTGGGGCTTCAACCAAGGCAAGTGGCCATTTGGTTCCAAAACAGAAGGGCTAGATGGAAGACTAAGCAATTGGAGAGGGATTATGAAATATTGAAGAGACAATTTGAGTCACTTAAGGCTGATAATGATGCTCTCAAGACTCAAAACAAGAAACTTCATGGAGAGTTATTGGCTCTAAAAGGTGGAGAATCAAACAATGGAAACAGACCAATTAATCTCAACAAAGAAACAGAGGCTTCGTGGAGCAATGGAAGCGAGAATAGTTGTGATCACCTACACGCAGGTCTAACACAAGCACTTTTCCAAAGCTCATCAACACCACACGATCTCAAAATCAATCCAGCTGTTGCTGATGAAAGCTTCTGCAACATGTTCAATGTCATTGAAGATCACCCGTCTGGGTTCTGGCCATGGACAGACCAAAATCAAAATTTTCAGTGA

Network for GWHGAAZE024305

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00046.30	Homeodomain	36	89	1.60E-15
PF02183.19	HALZ	91	130	2.80E-16

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	HB-HD-ZIP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0043565	molecular_function	sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.987
	SRR3591706	second leaf	0.540
	SRR3591707	mature leaf	0.086
	SRR3591708	Shoot apex	4.810
	SRR3591709	Stem	0.892
	SRR3591710	White floral bud	43.723
	SRR3591711	White flower	10.537
	SRR3591712	Green floral bud	8.752
	SRR3591713	Yellow flower	1.995
SRP173429	SRR8316895	Juvenile bud stage	2.204
	SRR8316896	Juvenile bud stage	2.067
	SRR8316897	Juvenile bud stage	0.503
	SRR8316894	Third green stage	1.121
	SRR8316900	Third green stage	3.200
	SRR8316901	Third green stage	4.215
	SRR8316898	Complete white stage	39.911
	SRR8316899	Complete white stage	10.856
	SRR8316903	Complete white stage	51.693
	SRR8316902	Silver flowering stage	12.905
	SRR8316904	Silver flowering stage	14.401
	SRR8316905	Silver flowering stage	9.115
	SRR8316906	Gold flowering stage	14.623
	SRR8316907	Gold flowering stage	16.372
	SRR8316908	Gold flowering stage	10.398
SRP132670	SRR6706286	Control	5.116
	SRR6706287	Light intensity 50%	7.087
	SRR6706288	Light intensity 20%	6.673
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.265
	CNS0095593	Slightly white alabastrum(diploid) 2	3.301
	CNS0095594	Slightly white alabastrum(diploid) 3	1.511
	CNS0095595	Whole white alabastrum(diploid) 2	1.375
	CNS0095596	Whole white alabastrum(diploid) 3	0.891
	CNS0095597	Whole white alabastrum(diploid) 4	1.873
	CNS0095598	Silvery flower (diploied) 1	2.693
	CNS0095599	Silvery flower (diploied) 2	3.727
	CNS0095600	Silvery flower (diploied) 3	10.039
	CNS0095601	Golden flower (diploid) 1	0.926
	CNS0095602	Golden flower (diploid) 2	2.360
	CNS0095603	Golden flower (diploid) 3	1.957
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.347
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.267
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.464
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.503
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.450
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.715
	CNS0095610	Silvery flower (tetraploid) 1	5.945
	CNS0095611	Silvery flower (tetraploid) 2	5.481
	CNS0095612	Silvery flower (tetraploid) 3	16.727
	CNS0095613	Golden flower (tetraploid) 1	1.116
	CNS0095614	Golden flower (tetraploid) 2	1.802
	CNS0095615	Golden flower (tetraploid) 3	0.352
CRA001975	CRR073297	Stem 1	9.784
	CRR073298	Stem 2	11.127
	CRR073299	Stem 3	7.240
	CRR073300	Leaf 1	14.839
	CRR073301	Leaf 2	10.935
	CRR073302	Leaf 3	9.405
	CRR073303	Juvenile bud 1	13.008
	CRR073304	Juvenile bud 2	25.401
	CRR073305	Juvenile bud 3	11.086
	CRR073306	Third green 1	43.519
	CRR073307	Third green 2	43.621
	CRR073308	Third green 3	48.008
	CRR073309	Second white 1	13.382
	CRR073310	Second white 2	4.166
	CRR073311	Second white 3	4.317
	CRR073312	Silver flowering 1	1.261
	CRR073313	Silver flowering 2	1.592
	CRR073314	Silver flowering 3	3.032
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.088
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000