Gene detail

Detail information of GWHGAAZE024439

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP32420.1	6.66658E-47	hypothetical protein JCGZ_13345 [Jatropha curcas]
COG	YP_004509659.1	2E-15	hypothetical protein PGTDC60_0936
trEMBL	tr\|A0A067KJH7\|A0A067KJH7_JATCU	2E-47	Uncharacterized protein {ECO:0000313\|EMBL:KDP32420.1}
TAIR10	AT5G20190.1	4E-33	Tetratricopeptide repeat (TPR)-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	42318251	42319485	+
GWHAAZE00000007	mRNA	42318251	42319485	+
GWHAAZE00000007	exon	42318251	42318334	+
GWHAAZE00000007	exon	42318818	42318990	+
GWHAAZE00000007	exon	42319302	42319485	+
GWHAAZE00000007	CDS	42318251	42318334	+
GWHAAZE00000007	CDS	42318818	42318990	+
GWHAAZE00000007	CDS	42319302	42319485	+

Transcript Sequence
>GWHTAAZE024473 ATGGATGTGTATTATAAGAAGATGATTGAGGCTAACCCTGCAAATCCCATGCTTCTTAGTAATTATGCTATGTTCTTGAAAGAGGTACGTCAGGACTTTGTAAAGGCTGAAGAGTACTATAGAAGAGCAATACTGGAAGACCCGAGTGATGGAAATGTTCTATCATTATATGCTGGTCTAATTTGGGATACCCAGAAGGATGCTACTAGAGCCTTAAGTTATTATAATCAAGCAATAAAAGCTGCACCCAACAACTGGGAAATTAGCGGATCGTATGCTCGGTTTATGTGGGACGCTGATTTGGAGGAAGATGAAGTAGGACAACGGGAAGAAGAAGATGTTGATGATGACAGGCAAGATACTTGCAATGCTTATGCATCACCAAATAGTTTCTTTCAAGGAAATCAACCACCGCCTCCTCCCATAGCTGCTGCTTCTTAG

Network for GWHGAAZE024439

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0043

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.436
	SRR3591706	second leaf	9.395
	SRR3591707	mature leaf	66.026
	SRR3591708	Shoot apex	4.914
	SRR3591709	Stem	6.363
	SRR3591710	White floral bud	9.780
	SRR3591711	White flower	6.161
	SRR3591712	Green floral bud	71.737
	SRR3591713	Yellow flower	1.588
SRP173429	SRR8316895	Juvenile bud stage	5.590
	SRR8316896	Juvenile bud stage	19.157
	SRR8316897	Juvenile bud stage	8.951
	SRR8316894	Third green stage	27.373
	SRR8316900	Third green stage	228.276
	SRR8316901	Third green stage	171.078
	SRR8316898	Complete white stage	11.854
	SRR8316899	Complete white stage	246.355
	SRR8316903	Complete white stage	14.932
	SRR8316902	Silver flowering stage	15.175
	SRR8316904	Silver flowering stage	10.920
	SRR8316905	Silver flowering stage	4.995
	SRR8316906	Gold flowering stage	9.521
	SRR8316907	Gold flowering stage	8.023
	SRR8316908	Gold flowering stage	9.974
SRP132670	SRR6706286	Control	73.407
	SRR6706287	Light intensity 50%	99.229
	SRR6706288	Light intensity 20%	109.186
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	31.966
	CNS0095593	Slightly white alabastrum(diploid) 2	92.378
	CNS0095594	Slightly white alabastrum(diploid) 3	36.002
	CNS0095595	Whole white alabastrum(diploid) 2	135.196
	CNS0095596	Whole white alabastrum(diploid) 3	154.111
	CNS0095597	Whole white alabastrum(diploid) 4	117.559
	CNS0095598	Silvery flower (diploied) 1	12.358
	CNS0095599	Silvery flower (diploied) 2	6.473
	CNS0095600	Silvery flower (diploied) 3	10.708
	CNS0095601	Golden flower (diploid) 1	5.829
	CNS0095602	Golden flower (diploid) 2	3.929
	CNS0095603	Golden flower (diploid) 3	3.172
	CNS0095604	Slightly white alabastrum(tetraploid) 1	51.528
	CNS0095605	Slightly white alabastrum(tetraploid) 2	35.631
	CNS0095606	Slightly white alabastrum(tetraploid) 3	65.261
	CNS0095607	Whole white alabastrum(tetraploid) 1	44.469
	CNS0095608	Whole white alabastrum(tetraploid) 2	65.520
	CNS0095609	Whole white alabastrum(tetraploid) 3	109.329
	CNS0095610	Silvery flower (tetraploid) 1	9.153
	CNS0095611	Silvery flower (tetraploid) 2	6.285
	CNS0095612	Silvery flower (tetraploid) 3	6.200
	CNS0095613	Golden flower (tetraploid) 1	2.450
	CNS0095614	Golden flower (tetraploid) 2	4.927
	CNS0095615	Golden flower (tetraploid) 3	0.096
CRA001975	CRR073297	Stem 1	16.914
	CRR073298	Stem 2	20.681
	CRR073299	Stem 3	8.056
	CRR073300	Leaf 1	67.484
	CRR073301	Leaf 2	81.422
	CRR073302	Leaf 3	58.097
	CRR073303	Juvenile bud 1	56.177
	CRR073304	Juvenile bud 2	36.683
	CRR073305	Juvenile bud 3	59.479
	CRR073306	Third green 1	0.618
	CRR073307	Third green 2	1.556
	CRR073308	Third green 3	2.299
	CRR073309	Second white 1	0.121
	CRR073310	Second white 2	0.717
	CRR073311	Second white 3	0.328
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.121
	CRR073314	Silver flowering 3	0.365
	CRR073315	Gold flowering 1	38.005
	CRR073316	Gold flowering 2	39.206
	CRR073317	Gold flowering 3	23.583
	CRR073318	Tawny withering 1	13.874
	CRR073319	Tawny withering 2	6.139
	CRR073320	Tawny withering 3	13.462