Gene detail

Detail information of GWHGAAZE024462

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011078388.1	1.30989E-59	PREDICTED: calmodulin-like protein 3 [Sesamum indicum]
COG	YP_007118813.1	9E-21	putative signal transduction protein with EFhand domain
Swissprot	tr\|Q9LNE7\|CML7_ARATH	8E-46	Calmodulin-like protein 7
trEMBL	tr\|F6HHA8\|F6HHA8_VITVI	2E-55	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB51604.1}
TAIR10	AT1G05990.1	5E-37	EF hand calcium-binding protein family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	42890436	42890912	-
GWHAAZE00000007	mRNA	42890436	42890912	-
GWHAAZE00000007	exon	42890436	42890912	-
GWHAAZE00000007	CDS	42890436	42890912	-

Transcript Sequence
>GWHTAAZE024496 ATGTCTGCTAGCAGCAATAGTATTACAGAGTTGAAGAGTGTTTTTGCCACTTTTGACAAAAACAGAGATGGCCTAGTCACCAAGAATGAACTCAGCGAGTCACTCAAAAATATCGGAATCAGTATGAGTGAGACAGAATTGGATGAAATGATCAAAAGGGTTGATGCAAATGGAGATGGGTTGATTGATTTTGACGAGTTCACTCAGTTGTTTGACTCGGTGGTGACTCGGGTCGACCATGGTGGTGATGGTTATTTGAGAGAGGCTTTTGATGTGTTTGATGGGAATGGTGATGGGTTAATAAGCTTTGAGGAATTGGGTTTGGTGCTTAATTCTTTGGGGATGAGTGAAGGGAAGAGATTAGAGGATTGTAAAGAGATGATTAAGATGGTTGATGCTGATGGTGATGGTATGGTTAATTTTGATGAGTTTAAAGTCATGATGAAGAGGGGGAAAATGATCTCGTCGTCCTCCTAA

Network for GWHGAAZE024462

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0261

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.7	EF-hand_7	10	71	1.00E-14
PF13499.7	EF-hand_7	86	149	1.10E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	51.984
	SRR3591706	second leaf	24.550
	SRR3591707	mature leaf	26.757
	SRR3591708	Shoot apex	34.366
	SRR3591709	Stem	72.373
	SRR3591710	White floral bud	30.700
	SRR3591711	White flower	23.239
	SRR3591712	Green floral bud	33.332
	SRR3591713	Yellow flower	5.186
SRP173429	SRR8316895	Juvenile bud stage	16.904
	SRR8316896	Juvenile bud stage	16.075
	SRR8316897	Juvenile bud stage	8.061
	SRR8316894	Third green stage	7.208
	SRR8316900	Third green stage	11.414
	SRR8316901	Third green stage	11.138
	SRR8316898	Complete white stage	0.415
	SRR8316899	Complete white stage	38.539
	SRR8316903	Complete white stage	3.155
	SRR8316902	Silver flowering stage	0.610
	SRR8316904	Silver flowering stage	0.733
	SRR8316905	Silver flowering stage	0.264
	SRR8316906	Gold flowering stage	1.158
	SRR8316907	Gold flowering stage	1.266
	SRR8316908	Gold flowering stage	0.211
SRP132670	SRR6706286	Control	8.502
	SRR6706287	Light intensity 50%	8.768
	SRR6706288	Light intensity 20%	7.589
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	19.211
	CNS0095593	Slightly white alabastrum(diploid) 2	18.328
	CNS0095594	Slightly white alabastrum(diploid) 3	18.933
	CNS0095595	Whole white alabastrum(diploid) 2	16.225
	CNS0095596	Whole white alabastrum(diploid) 3	6.350
	CNS0095597	Whole white alabastrum(diploid) 4	16.869
	CNS0095598	Silvery flower (diploied) 1	23.492
	CNS0095599	Silvery flower (diploied) 2	11.799
	CNS0095600	Silvery flower (diploied) 3	7.224
	CNS0095601	Golden flower (diploid) 1	16.143
	CNS0095602	Golden flower (diploid) 2	13.663
	CNS0095603	Golden flower (diploid) 3	10.971
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.354
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.765
	CNS0095606	Slightly white alabastrum(tetraploid) 3	11.109
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.677
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.997
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.204
	CNS0095610	Silvery flower (tetraploid) 1	1.694
	CNS0095611	Silvery flower (tetraploid) 2	2.913
	CNS0095612	Silvery flower (tetraploid) 3	3.553
	CNS0095613	Golden flower (tetraploid) 1	0.628
	CNS0095614	Golden flower (tetraploid) 2	2.199
	CNS0095615	Golden flower (tetraploid) 3	0.662
CRA001975	CRR073297	Stem 1	23.541
	CRR073298	Stem 2	24.464
	CRR073299	Stem 3	36.910
	CRR073300	Leaf 1	27.847
	CRR073301	Leaf 2	36.326
	CRR073302	Leaf 3	23.189
	CRR073303	Juvenile bud 1	22.448
	CRR073304	Juvenile bud 2	15.981
	CRR073305	Juvenile bud 3	33.471
	CRR073306	Third green 1	3.027
	CRR073307	Third green 2	4.086
	CRR073308	Third green 3	6.577
	CRR073309	Second white 1	1.627
	CRR073310	Second white 2	2.019
	CRR073311	Second white 3	2.590
	CRR073312	Silver flowering 1	1.488
	CRR073313	Silver flowering 2	4.127
	CRR073314	Silver flowering 3	1.846
	CRR073315	Gold flowering 1	65.837
	CRR073316	Gold flowering 2	62.300
	CRR073317	Gold flowering 3	59.577
	CRR073318	Tawny withering 1	75.515
	CRR073319	Tawny withering 2	68.454
	CRR073320	Tawny withering 3	91.025