Gene detail

Detail information of GWHGAAZE024559

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADR71238.1	2.20144E-34	30S ribosomal protein S6B [Hevea brasiliensis]
trEMBL	tr\|I3NMK1\|I3NMK1_HEVBR	8E-35	30S ribosomal protein S6B {ECO:0000313\|EMBL:ADR71238.1}
TAIR10	AT3G18760.2	2E-25	Translation elongation factor EF1B/ribosomal protein S6 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	45118317	45119125	+
GWHAAZE00000007	mRNA	45118317	45119125	+
GWHAAZE00000007	exon	45118317	45118499	+
GWHAAZE00000007	exon	45119096	45119125	+
GWHAAZE00000007	CDS	45118317	45118499	+
GWHAAZE00000007	CDS	45119096	45119125	+

Transcript Sequence
>GWHTAAZE024593 ATGCCTTTATACGATTGTATGCTGTTGTTGAAACCTCACGTAACGAAGGAATCATTGATGGATTTGGTAGCTCGAGTGGGGAAACACGTGTACAGTAGAAATGGAGTTCTAACTGAGATCAAATCATTTGGTACTGTTCAATTAGGTTATGGTGTTAAAAAGCTTGATGGAAGATACTATCAGTTCATTGCTGTAGTGTTTTCTTCAACATAA

Network for GWHGAAZE024559

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01250.18	Ribosomal_S6	4	64	1.30E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02990	RP-S6, MRPS6, rpsF	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome
GO:0019843	molecular_function	rRNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	33.406
	SRR3591706	second leaf	16.106
	SRR3591707	mature leaf	12.424
	SRR3591708	Shoot apex	32.606
	SRR3591709	Stem	21.508
	SRR3591710	White floral bud	16.866
	SRR3591711	White flower	25.473
	SRR3591712	Green floral bud	23.747
	SRR3591713	Yellow flower	23.980
SRP173429	SRR8316895	Juvenile bud stage	18.206
	SRR8316896	Juvenile bud stage	21.994
	SRR8316897	Juvenile bud stage	11.216
	SRR8316894	Third green stage	9.367
	SRR8316900	Third green stage	26.682
	SRR8316901	Third green stage	24.162
	SRR8316898	Complete white stage	8.408
	SRR8316899	Complete white stage	31.193
	SRR8316903	Complete white stage	15.368
	SRR8316902	Silver flowering stage	13.091
	SRR8316904	Silver flowering stage	20.526
	SRR8316905	Silver flowering stage	10.264
	SRR8316906	Gold flowering stage	28.723
	SRR8316907	Gold flowering stage	32.240
	SRR8316908	Gold flowering stage	29.396
SRP132670	SRR6706286	Control	41.626
	SRR6706287	Light intensity 50%	40.890
	SRR6706288	Light intensity 20%	43.334
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	28.726
	CNS0095593	Slightly white alabastrum(diploid) 2	26.260
	CNS0095594	Slightly white alabastrum(diploid) 3	27.286
	CNS0095595	Whole white alabastrum(diploid) 2	24.265
	CNS0095596	Whole white alabastrum(diploid) 3	17.041
	CNS0095597	Whole white alabastrum(diploid) 4	21.535
	CNS0095598	Silvery flower (diploied) 1	30.206
	CNS0095599	Silvery flower (diploied) 2	26.061
	CNS0095600	Silvery flower (diploied) 3	27.081
	CNS0095601	Golden flower (diploid) 1	20.429
	CNS0095602	Golden flower (diploid) 2	23.465
	CNS0095603	Golden flower (diploid) 3	20.646
	CNS0095604	Slightly white alabastrum(tetraploid) 1	36.980
	CNS0095605	Slightly white alabastrum(tetraploid) 2	27.053
	CNS0095606	Slightly white alabastrum(tetraploid) 3	45.193
	CNS0095607	Whole white alabastrum(tetraploid) 1	12.385
	CNS0095608	Whole white alabastrum(tetraploid) 2	13.768
	CNS0095609	Whole white alabastrum(tetraploid) 3	34.134
	CNS0095610	Silvery flower (tetraploid) 1	53.149
	CNS0095611	Silvery flower (tetraploid) 2	40.675
	CNS0095612	Silvery flower (tetraploid) 3	36.863
	CNS0095613	Golden flower (tetraploid) 1	37.439
	CNS0095614	Golden flower (tetraploid) 2	42.474
	CNS0095615	Golden flower (tetraploid) 3	21.909
CRA001975	CRR073297	Stem 1	14.137
	CRR073298	Stem 2	15.002
	CRR073299	Stem 3	14.277
	CRR073300	Leaf 1	18.613
	CRR073301	Leaf 2	25.794
	CRR073302	Leaf 3	14.952
	CRR073303	Juvenile bud 1	24.211
	CRR073304	Juvenile bud 2	12.313
	CRR073305	Juvenile bud 3	8.512
	CRR073306	Third green 1	3.476
	CRR073307	Third green 2	7.272
	CRR073308	Third green 3	4.127
	CRR073309	Second white 1	7.629
	CRR073310	Second white 2	7.940
	CRR073311	Second white 3	5.536
	CRR073312	Silver flowering 1	4.677
	CRR073313	Silver flowering 2	6.322
	CRR073314	Silver flowering 3	4.501
	CRR073315	Gold flowering 1	5.633
	CRR073316	Gold flowering 2	10.534
	CRR073317	Gold flowering 3	3.274
	CRR073318	Tawny withering 1	24.975
	CRR073319	Tawny withering 2	17.785
	CRR073320	Tawny withering 3	16.893