Gene detail

Detail information of GWHGAAZE024661

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010656831.1	5.19983E-37	PREDICTED: zinc finger protein 2 [Vitis vinifera]
Swissprot	tr\|Q39261\|ZFP2_ARATH	7E-25	Zinc finger protein 2
trEMBL	tr\|F6GXF3\|F6GXF3_VITVI	2E-37	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB44639.1}
TAIR10	AT5G57520.1	7E-19	zinc finger protein 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	47235181	47235582	+
GWHAAZE00000007	mRNA	47235181	47235582	+
GWHAAZE00000007	exon	47235181	47235582	+
GWHAAZE00000007	CDS	47235181	47235582	+

Transcript Sequence
>GWHTAAZE024695 ATGAGTTTTCAACCAAATACCTCCCTTAGTCTAAACCTACCCACCAATGACCTCAGACTTGACCTCCTACTAGACCTCTCTTCCTCCTCTTCTTCTTTATCTCCCTCACCTCCCAGCCGAGCCGAGCCCCGAGTCTTTTCTTGTAACTATTGTAGCAGAAAATTCTATAGCTCACAAGCACTTGGGGGCCACCAAAATGCCCACAAGCTTGAAAGAACCCTTGCCAAGAAAAGCCGGGTGCTCGGCTTGACCCGCCGCTCACCCTCCAGCAGCTGGAGCCATGTTGGACAGGTGCAGCCACCCGATCAAGCTCGTGGTGGCAGGAAAGAAATCAATTATAGTTCTATAGATGGAGACGTACAAGAGGAGTTCAGCCAGCTTGATTTATCTCTTAGGCTTTAA

Network for GWHGAAZE024661

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2H2

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003676	molecular_function	nucleic acid binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	1.876
	SRR3591707	mature leaf	0.166
	SRR3591708	Shoot apex	3.121
	SRR3591709	Stem	1.463
	SRR3591710	White floral bud	2.523
	SRR3591711	White flower	9.371
	SRR3591712	Green floral bud	0.322
	SRR3591713	Yellow flower	1.499
SRP173429	SRR8316895	Juvenile bud stage	0.254
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	1.302
	SRR8316900	Third green stage	0.241
	SRR8316901	Third green stage	0.441
	SRR8316898	Complete white stage	0.672
	SRR8316899	Complete white stage	2.654
	SRR8316903	Complete white stage	10.838
	SRR8316902	Silver flowering stage	0.235
	SRR8316904	Silver flowering stage	1.388
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.674
	SRR8316907	Gold flowering stage	5.065
	SRR8316908	Gold flowering stage	4.485
SRP132670	SRR6706286	Control	2.751
	SRR6706287	Light intensity 50%	3.970
	SRR6706288	Light intensity 20%	3.053
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.209
	CNS0095593	Slightly white alabastrum(diploid) 2	1.148
	CNS0095594	Slightly white alabastrum(diploid) 3	0.642
	CNS0095595	Whole white alabastrum(diploid) 2	0.797
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.118
	CNS0095598	Silvery flower (diploied) 1	29.684
	CNS0095599	Silvery flower (diploied) 2	10.283
	CNS0095600	Silvery flower (diploied) 3	2.847
	CNS0095601	Golden flower (diploid) 1	7.604
	CNS0095602	Golden flower (diploid) 2	17.790
	CNS0095603	Golden flower (diploid) 3	15.873
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.375
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.562
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.621
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.021
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.111
	CNS0095610	Silvery flower (tetraploid) 1	1.801
	CNS0095611	Silvery flower (tetraploid) 2	3.712
	CNS0095612	Silvery flower (tetraploid) 3	0.364
	CNS0095613	Golden flower (tetraploid) 1	11.136
	CNS0095614	Golden flower (tetraploid) 2	6.995
	CNS0095615	Golden flower (tetraploid) 3	4.148
CRA001975	CRR073297	Stem 1	1.632
	CRR073298	Stem 2	2.704
	CRR073299	Stem 3	1.755
	CRR073300	Leaf 1	0.119
	CRR073301	Leaf 2	0.008
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.080
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.652
	CRR073313	Silver flowering 2	0.460
	CRR073314	Silver flowering 3	0.729
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	1.596
	CRR073319	Tawny withering 2	1.231
	CRR073320	Tawny withering 3	0.747