Gene detail

Detail information of GWHGAAZE024857

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011092990.1	3.55136E-65	PREDICTED: WRKY transcription factor 22 [Sesamum indicum]
Swissprot	tr\|O04609\|WRK22_ARATH	6E-48	WRKY transcription factor 22
trEMBL	tr\|B9I8Q1\|B9I8Q1_POPTR	1E-59	Transcription factor family protein {ECO:0000313\|EMBL:EEE98473.1}
TAIR10	AT4G01250.1	2E-38	WRKY family transcription factor

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	50730095	50731313	-
GWHAAZE00000007	mRNA	50730095	50731313	-
GWHAAZE00000007	exon	50731252	50731313	-
GWHAAZE00000007	exon	50730095	50730527	-
GWHAAZE00000007	CDS	50731252	50731313	-
GWHAAZE00000007	CDS	50730095	50730527	-

Transcript Sequence
>GWHTAAZE024891 ATGAAAAGGGTTTGCCAAGTGCCAGCTGAGGGTTTATCTTCTGATATGTGGTCTTGGAGAAAGGGCTACTACAGATGTAGCACTTCAAAGGGTTGTTTGGCCCGAAAACAAGTGGAGCGCCACAGATCCGACCCGATTATGTTCATAGTCACCTACACCGGTGACCACAACCACCCTATGCCTACCCACCGGAACTCACTCGCCGGAAGTACCCGCCAAAAACCCACCTCCACCTCCGGCGAGCAAAACAAACCCACTTGCTCCTCTCCGGTATCACCGGCAGCGACCCTCTCGCCGACGACGGAGAAAGATGATGACGATTTTGGGGTCTCCGATATGGCCTTAAGTGATGATTTCTTTGCGGGTTTGGAGGATATCGCGGGCCCGGTTGACGGAGATGGGTTTTCCGATCAGTTTGCAGAGAGTATGCCGTTTCCTTGGTTGGCTAATAATGTAACTACCGCCACCGCCGCAGCCGCCGTGGACGGTGGTTGA

Network for GWHGAAZE024857

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03106.16	WRKY	21	59	1.80E-11

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	WRKY

KEGG pathway

KO	Enzyme	pathway	mapID
K13425	WRKY22	MAPK signaling pathway - plant	map04016
K13425	WRKY22	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0043565	molecular_function	sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	9.095
	SRR3591706	second leaf	12.372
	SRR3591707	mature leaf	15.898
	SRR3591708	Shoot apex	14.375
	SRR3591709	Stem	28.930
	SRR3591710	White floral bud	7.761
	SRR3591711	White flower	18.275
	SRR3591712	Green floral bud	11.374
	SRR3591713	Yellow flower	6.903
SRP173429	SRR8316895	Juvenile bud stage	25.131
	SRR8316896	Juvenile bud stage	23.421
	SRR8316897	Juvenile bud stage	17.334
	SRR8316894	Third green stage	9.675
	SRR8316900	Third green stage	13.732
	SRR8316901	Third green stage	19.960
	SRR8316898	Complete white stage	2.724
	SRR8316899	Complete white stage	30.629
	SRR8316903	Complete white stage	4.622
	SRR8316902	Silver flowering stage	6.574
	SRR8316904	Silver flowering stage	3.466
	SRR8316905	Silver flowering stage	1.442
	SRR8316906	Gold flowering stage	8.577
	SRR8316907	Gold flowering stage	7.505
	SRR8316908	Gold flowering stage	8.743
SRP132670	SRR6706286	Control	4.008
	SRR6706287	Light intensity 50%	6.922
	SRR6706288	Light intensity 20%	6.239
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	22.164
	CNS0095593	Slightly white alabastrum(diploid) 2	30.697
	CNS0095594	Slightly white alabastrum(diploid) 3	32.768
	CNS0095595	Whole white alabastrum(diploid) 2	21.753
	CNS0095596	Whole white alabastrum(diploid) 3	4.046
	CNS0095597	Whole white alabastrum(diploid) 4	14.179
	CNS0095598	Silvery flower (diploied) 1	49.238
	CNS0095599	Silvery flower (diploied) 2	35.402
	CNS0095600	Silvery flower (diploied) 3	21.991
	CNS0095601	Golden flower (diploid) 1	24.466
	CNS0095602	Golden flower (diploid) 2	20.400
	CNS0095603	Golden flower (diploid) 3	21.718
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.814
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.054
	CNS0095606	Slightly white alabastrum(tetraploid) 3	10.340
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.980
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.667
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.307
	CNS0095610	Silvery flower (tetraploid) 1	2.641
	CNS0095611	Silvery flower (tetraploid) 2	1.465
	CNS0095612	Silvery flower (tetraploid) 3	6.482
	CNS0095613	Golden flower (tetraploid) 1	6.717
	CNS0095614	Golden flower (tetraploid) 2	2.824
	CNS0095615	Golden flower (tetraploid) 3	2.081
CRA001975	CRR073297	Stem 1	8.892
	CRR073298	Stem 2	8.232
	CRR073299	Stem 3	10.578
	CRR073300	Leaf 1	11.523
	CRR073301	Leaf 2	16.238
	CRR073302	Leaf 3	5.588
	CRR073303	Juvenile bud 1	7.807
	CRR073304	Juvenile bud 2	7.750
	CRR073305	Juvenile bud 3	15.809
	CRR073306	Third green 1	4.168
	CRR073307	Third green 2	2.956
	CRR073308	Third green 3	3.858
	CRR073309	Second white 1	3.927
	CRR073310	Second white 2	3.389
	CRR073311	Second white 3	1.844
	CRR073312	Silver flowering 1	7.721
	CRR073313	Silver flowering 2	8.703
	CRR073314	Silver flowering 3	2.884
	CRR073315	Gold flowering 1	7.164
	CRR073316	Gold flowering 2	7.252
	CRR073317	Gold flowering 3	6.305
	CRR073318	Tawny withering 1	7.852
	CRR073319	Tawny withering 2	32.720
	CRR073320	Tawny withering 3	8.390