Gene detail

Detail information of GWHGAAZE024874

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011092673.1	3.2855E-124	PREDICTED: ubiquitin-conjugating enzyme E2-23 kDa [Sesamum indicum]
COG	YP_008797956.1	5E-15	ubiquitin-conjugating enzyme E2-like protein
Swissprot	tr\|P42749\|UBC5_ARATH	2E-107	Ubiquitin-conjugating enzyme E2 5
trEMBL	tr\|M5WAS9\|M5WAS9_PRUPE	2E-122	Uncharacterized protein {ECO:0000313\|EMBL:EMJ10857.1}
TAIR10	AT5G41340.1	9E-79	ubiquitin conjugating enzyme 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	51012221	51017167	+
GWHAAZE00000007	mRNA	51012221	51017167	+
GWHAAZE00000007	exon	51012221	51012264	+
GWHAAZE00000007	exon	51012361	51012440	+
GWHAAZE00000007	exon	51013170	51013284	+
GWHAAZE00000007	exon	51014189	51014241	+
GWHAAZE00000007	exon	51014350	51014478	+
GWHAAZE00000007	exon	51017037	51017167	+
GWHAAZE00000007	CDS	51012221	51012264	+
GWHAAZE00000007	CDS	51012361	51012440	+
GWHAAZE00000007	CDS	51013170	51013284	+
GWHAAZE00000007	CDS	51014189	51014241	+
GWHAAZE00000007	CDS	51014350	51014478	+
GWHAAZE00000007	CDS	51017037	51017167	+

Transcript Sequence
>GWHTAAZE024908 ATGTCTTCACCAAGCAAACGCAGAGAGATGGACTTGATGAAGCTGATGATGAGTGATTACAAGGTAGAGATGATCAACGATGGGATGCAAGAGTTCTATGTTGATTTCAATGGACCCACTGACAGTCCTTACCAGGGAGGTGTATGGAGGGTAAGGGTTGAACTTCCAGATGCTTATCCCTATAAATCTCCATCCATTGGATTTGTTAATAAGATCTACCACCCGAACGTTGATGAAATGTCAGGATCGGTTTGCCTAGATGTTATCAATCAAACTTGGAGCCCCATGTTTGATTTGGTAAATGTGTTTGAAGTTTTCCTTCCGCAACTTCTTTTGTACCCGAACCCATCGGACCCATTGAATGGGGAGGCAGCAGCTCTAATGATGCGTGATCGAGCTGCTTATGAACAAAGAGTTAAAGAATATTGCGAGAAATACGCTAAGGCTGAAGACGTGGGAGCTGCCCCGGAGGAGAAATCGAGTGACGAGGAACTGAGCGAAGACGAGTATGACTCCAGCGATGATGCAGTGGTGGGACCTGTGGACCCATAG

Network for GWHGAAZE024874

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00179.27	UQ_con	10	142	4.20E-39

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	UBC

KEGG pathway

KO	Enzyme	pathway	mapID
K10576	UBE2H, UBC8	Ubiquitin mediated proteolysis	map04120

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	57.731
	SRR3591706	second leaf	33.124
	SRR3591707	mature leaf	29.662
	SRR3591708	Shoot apex	52.365
	SRR3591709	Stem	134.735
	SRR3591710	White floral bud	98.089
	SRR3591711	White flower	154.392
	SRR3591712	Green floral bud	60.587
	SRR3591713	Yellow flower	219.839
SRP173429	SRR8316895	Juvenile bud stage	52.770
	SRR8316896	Juvenile bud stage	82.492
	SRR8316897	Juvenile bud stage	44.572
	SRR8316894	Third green stage	28.423
	SRR8316900	Third green stage	89.366
	SRR8316901	Third green stage	83.976
	SRR8316898	Complete white stage	84.214
	SRR8316899	Complete white stage	178.185
	SRR8316903	Complete white stage	113.673
	SRR8316902	Silver flowering stage	118.974
	SRR8316904	Silver flowering stage	138.113
	SRR8316905	Silver flowering stage	79.584
	SRR8316906	Gold flowering stage	307.458
	SRR8316907	Gold flowering stage	309.401
	SRR8316908	Gold flowering stage	280.563
SRP132670	SRR6706286	Control	57.595
	SRR6706287	Light intensity 50%	60.626
	SRR6706288	Light intensity 20%	64.650
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	91.373
	CNS0095593	Slightly white alabastrum(diploid) 2	95.988
	CNS0095594	Slightly white alabastrum(diploid) 3	71.157
	CNS0095595	Whole white alabastrum(diploid) 2	75.658
	CNS0095596	Whole white alabastrum(diploid) 3	58.877
	CNS0095597	Whole white alabastrum(diploid) 4	84.763
	CNS0095598	Silvery flower (diploied) 1	132.399
	CNS0095599	Silvery flower (diploied) 2	143.074
	CNS0095600	Silvery flower (diploied) 3	192.450
	CNS0095601	Golden flower (diploid) 1	150.765
	CNS0095602	Golden flower (diploid) 2	163.836
	CNS0095603	Golden flower (diploid) 3	165.888
	CNS0095604	Slightly white alabastrum(tetraploid) 1	109.166
	CNS0095605	Slightly white alabastrum(tetraploid) 2	91.010
	CNS0095606	Slightly white alabastrum(tetraploid) 3	129.049
	CNS0095607	Whole white alabastrum(tetraploid) 1	68.678
	CNS0095608	Whole white alabastrum(tetraploid) 2	72.804
	CNS0095609	Whole white alabastrum(tetraploid) 3	88.742
	CNS0095610	Silvery flower (tetraploid) 1	231.075
	CNS0095611	Silvery flower (tetraploid) 2	209.003
	CNS0095612	Silvery flower (tetraploid) 3	253.800
	CNS0095613	Golden flower (tetraploid) 1	278.820
	CNS0095614	Golden flower (tetraploid) 2	237.260
	CNS0095615	Golden flower (tetraploid) 3	256.595
CRA001975	CRR073297	Stem 1	61.786
	CRR073298	Stem 2	58.753
	CRR073299	Stem 3	61.451
	CRR073300	Leaf 1	77.593
	CRR073301	Leaf 2	70.892
	CRR073302	Leaf 3	54.973
	CRR073303	Juvenile bud 1	92.732
	CRR073304	Juvenile bud 2	71.156
	CRR073305	Juvenile bud 3	79.307
	CRR073306	Third green 1	77.014
	CRR073307	Third green 2	76.776
	CRR073308	Third green 3	63.954
	CRR073309	Second white 1	124.036
	CRR073310	Second white 2	126.523
	CRR073311	Second white 3	92.539
	CRR073312	Silver flowering 1	93.560
	CRR073313	Silver flowering 2	93.347
	CRR073314	Silver flowering 3	86.900
	CRR073315	Gold flowering 1	30.001
	CRR073316	Gold flowering 2	41.874
	CRR073317	Gold flowering 3	26.932
	CRR073318	Tawny withering 1	77.165
	CRR073319	Tawny withering 2	60.906
	CRR073320	Tawny withering 3	57.092