Gene detail

Detail information of GWHGAAZE024982

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009596116.1	7.50552E-81	PREDICTED: 40S ribosomal protein S13-like [Nicotiana tomentosiformis]
COG	YP_003816538.1	3E-36	30S ribosomal protein S15P/S13e
Swissprot	tr\|P62302\|RS13_SOYBN	2E-80	40S ribosomal protein S13
trEMBL	tr\|M5WJE0\|M5WJE0_PRUPE	1E-79	Uncharacterized protein {ECO:0000313\|EMBL:EMJ13396.1}
TAIR10	AT4G00100.1	2E-62	ribosomal protein S13A

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	53031371	53033030	+
GWHAAZE00000007	mRNA	53031371	53033030	+
GWHAAZE00000007	exon	53031371	53031566	+
GWHAAZE00000007	exon	53031944	53032130	+
GWHAAZE00000007	exon	53032997	53033030	+
GWHAAZE00000007	CDS	53031371	53031566	+
GWHAAZE00000007	CDS	53031944	53032130	+
GWHAAZE00000007	CDS	53032997	53033030	+

Transcript Sequence
>GWHTAAZE025016 ATGAATTTAATTGATGTGTATATTAATTTATTGTTTTTATTCTTTCCTACCATTCAGGTTGAGGAAAATATCTGTAGGTTTGCGAAGAAAGGTCTTACACCTTCTCAAATTGGGGTTATTCTTCGTGATTCTCATGGGGTTGCTCAGGTGAAGAGTGTCACTGGCAGCAAGATTTTGCGGATACTTAAGGCTCATGGGCTTGCTCCAGAAATACCCGAGGATCTTTACCACCTCATTAAGAAAGCCGTGGCCATTAGGAAGCATCTGGAAAGGAACAGAAAGGATAAGGATTCTAAATTCAGGTTGATTCTTGTTGAGAGCAGAATTCACCGACTTGCTCGTTACTACAAGAAGACAAAGAAGCTTCCACCAGTTTGGAAATACGAATCAACCACAGCCAGCACTCTTGTGGCCTAA

Network for GWHGAAZE024982

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF08069.13	Ribosomal_S13_N	19	47	6.80E-12
PF00312.23	Ribosomal_S15	61	132	3.60E-15

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02953	RP-S13e, RPS13	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	123.862
	SRR3591706	second leaf	80.417
	SRR3591707	mature leaf	41.906
	SRR3591708	Shoot apex	189.393
	SRR3591709	Stem	70.030
	SRR3591710	White floral bud	50.685
	SRR3591711	White flower	72.509
	SRR3591712	Green floral bud	89.813
	SRR3591713	Yellow flower	61.161
SRP173429	SRR8316895	Juvenile bud stage	67.989
	SRR8316896	Juvenile bud stage	91.696
	SRR8316897	Juvenile bud stage	42.430
	SRR8316894	Third green stage	31.041
	SRR8316900	Third green stage	106.285
	SRR8316901	Third green stage	103.765
	SRR8316898	Complete white stage	33.123
	SRR8316899	Complete white stage	112.006
	SRR8316903	Complete white stage	40.526
	SRR8316902	Silver flowering stage	31.327
	SRR8316904	Silver flowering stage	26.180
	SRR8316905	Silver flowering stage	19.013
	SRR8316906	Gold flowering stage	57.675
	SRR8316907	Gold flowering stage	60.864
	SRR8316908	Gold flowering stage	62.386
SRP132670	SRR6706286	Control	71.443
	SRR6706287	Light intensity 50%	65.364
	SRR6706288	Light intensity 20%	76.989
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	110.008
	CNS0095593	Slightly white alabastrum(diploid) 2	124.937
	CNS0095594	Slightly white alabastrum(diploid) 3	101.917
	CNS0095595	Whole white alabastrum(diploid) 2	84.204
	CNS0095596	Whole white alabastrum(diploid) 3	98.526
	CNS0095597	Whole white alabastrum(diploid) 4	65.693
	CNS0095598	Silvery flower (diploied) 1	61.331
	CNS0095599	Silvery flower (diploied) 2	56.883
	CNS0095600	Silvery flower (diploied) 3	49.527
	CNS0095601	Golden flower (diploid) 1	45.127
	CNS0095602	Golden flower (diploid) 2	43.559
	CNS0095603	Golden flower (diploid) 3	42.417
	CNS0095604	Slightly white alabastrum(tetraploid) 1	81.555
	CNS0095605	Slightly white alabastrum(tetraploid) 2	92.133
	CNS0095606	Slightly white alabastrum(tetraploid) 3	113.037
	CNS0095607	Whole white alabastrum(tetraploid) 1	49.873
	CNS0095608	Whole white alabastrum(tetraploid) 2	36.695
	CNS0095609	Whole white alabastrum(tetraploid) 3	68.238
	CNS0095610	Silvery flower (tetraploid) 1	47.329
	CNS0095611	Silvery flower (tetraploid) 2	43.800
	CNS0095612	Silvery flower (tetraploid) 3	33.034
	CNS0095613	Golden flower (tetraploid) 1	35.303
	CNS0095614	Golden flower (tetraploid) 2	37.668
	CNS0095615	Golden flower (tetraploid) 3	31.554
CRA001975	CRR073297	Stem 1	80.606
	CRR073298	Stem 2	71.491
	CRR073299	Stem 3	107.780
	CRR073300	Leaf 1	62.111
	CRR073301	Leaf 2	76.081
	CRR073302	Leaf 3	94.643
	CRR073303	Juvenile bud 1	73.427
	CRR073304	Juvenile bud 2	74.080
	CRR073305	Juvenile bud 3	78.803
	CRR073306	Third green 1	23.974
	CRR073307	Third green 2	30.362
	CRR073308	Third green 3	29.828
	CRR073309	Second white 1	24.585
	CRR073310	Second white 2	28.084
	CRR073311	Second white 3	19.971
	CRR073312	Silver flowering 1	27.662
	CRR073313	Silver flowering 2	25.353
	CRR073314	Silver flowering 3	22.226
	CRR073315	Gold flowering 1	48.488
	CRR073316	Gold flowering 2	45.550
	CRR073317	Gold flowering 3	58.624
	CRR073318	Tawny withering 1	82.213
	CRR073319	Tawny withering 2	70.990
	CRR073320	Tawny withering 3	102.564