Gene detail

Detail information of GWHGAAZE025005

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009793075.1	1.3286E-152	PREDICTED: Golgi SNAP receptor complex member 1-2 [Nicotiana sylvestris]
Swissprot	tr\|O22151\|GOS12_ARATH	1E-144	Golgi SNAP receptor complex member 1-2
trEMBL	tr\|A0A022QTC0\|A0A022QTC0_ERYGU	2E-152	Golgi SNAP receptor complex member 1 {ECO:0000256\|PIRNR:PIRNR027109}
TAIR10	AT2G45200.1	8E-112	golgi snare 12

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	53329257	53334884	+
GWHAAZE00000007	mRNA	53329257	53334884	+
GWHAAZE00000007	exon	53329257	53329463	+
GWHAAZE00000007	exon	53331780	53331985	+
GWHAAZE00000007	exon	53332181	53332270	+
GWHAAZE00000007	exon	53332362	53332433	+
GWHAAZE00000007	exon	53334564	53334693	+
GWHAAZE00000007	exon	53334787	53334884	+
GWHAAZE00000007	five_prime_UTR	53329257	53329330	+
GWHAAZE00000007	CDS	53329331	53329463	+
GWHAAZE00000007	CDS	53331780	53331985	+
GWHAAZE00000007	CDS	53332181	53332270	+
GWHAAZE00000007	CDS	53332362	53332433	+
GWHAAZE00000007	CDS	53334564	53334693	+
GWHAAZE00000007	CDS	53334787	53334884	+

Transcript Sequence
>GWHTAAZE025039 GGAGAGGAGCAGAAGAATAACAATAAGGAGGAGGAACAATAAACGGATCGGATCCAATCCGTCAGGCAGGAGAAATGGCAGGGGATCCGAGTATCGATCAGGAATTGGGTTGGGAGGAACTGAGAAAAGAGGCTCGCAAAATCGAAGGCGATCTCGATGTTAAACTCTCTTCCTATGCTAAACTCGGCGCTAGGTTTTCACAAGGAGGTTATGTGGATAGTAGTGGACCTGGTTCACCAACTCTTGGGTCGAGCAGATCATGGAAGTCCATGGAAATGGAGATTCAATCGTTGCTTGAGAAGCTACTGGATGTTAATGATTCAATGAGTCGATGTGCTGCATCTGCTGCTCCTACTACTTCAGTTACCCAGAAGCTGGCAAGGCATAGGGATATACTTCATGAGTTTACCCAGGAATTTAGAAGAATCAAGGGAAACATAACTTCAATGAAGGAACATGCAGAGCTTCTCACTTCTGTAAGAGATGACATCAGTGAGTACAAGGCATCTGGGAGCATGTCGCCACAGAAGCAGTTACTTCGTGAGAGAGCTGCGATACATGGAAATATAGCTCATATGGATGATGTCATTAGTCAAGCTCAAACCACAAGGGCGGCCTTGGGATCTCAAAGGGCTTTGTTTGGTGATGTCCAAGGCAAAGTGAAGCAACTAGGTGACAAGTTTCCCATTGTCCGAGGACTAATTGGTTCAATTAGAAGGAAGAAATCGAGGGACACACTCATCCTATCTGCAGTCATTGCAGCCTGTACGTTATTTCTTATTATATACTGGCTTTCTAAGTAA

Network for GWHGAAZE025005

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF12352.9	V-SNARE_C	153	217	2.60E-15

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08495	GOSR1, GOS1	SNARE interactions in vesicular transport	map04130

Gene Ontology

GO term	Ontology	Name
GO:0006888	biological_process	endoplasmic reticulum to Golgi vesicle-mediated transport
GO:0000139	cellular_component	Golgi membrane
GO:0005801	cellular_component	cis-Golgi network
GO:0016021	cellular_component	integral component of membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.028
	SRR3591706	second leaf	6.475
	SRR3591707	mature leaf	7.032
	SRR3591708	Shoot apex	7.096
	SRR3591709	Stem	4.861
	SRR3591710	White floral bud	6.213
	SRR3591711	White flower	6.232
	SRR3591712	Green floral bud	11.491
	SRR3591713	Yellow flower	7.280
SRP173429	SRR8316895	Juvenile bud stage	5.092
	SRR8316896	Juvenile bud stage	10.578
	SRR8316897	Juvenile bud stage	5.090
	SRR8316894	Third green stage	4.880
	SRR8316900	Third green stage	16.452
	SRR8316901	Third green stage	17.607
	SRR8316898	Complete white stage	2.110
	SRR8316899	Complete white stage	7.839
	SRR8316903	Complete white stage	1.753
	SRR8316902	Silver flowering stage	1.691
	SRR8316904	Silver flowering stage	2.425
	SRR8316905	Silver flowering stage	0.914
	SRR8316906	Gold flowering stage	5.703
	SRR8316907	Gold flowering stage	5.952
	SRR8316908	Gold flowering stage	5.657
SRP132670	SRR6706286	Control	7.507
	SRR6706287	Light intensity 50%	8.373
	SRR6706288	Light intensity 20%	7.248
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	18.874
	CNS0095593	Slightly white alabastrum(diploid) 2	15.009
	CNS0095594	Slightly white alabastrum(diploid) 3	20.196
	CNS0095595	Whole white alabastrum(diploid) 2	22.663
	CNS0095596	Whole white alabastrum(diploid) 3	21.821
	CNS0095597	Whole white alabastrum(diploid) 4	21.250
	CNS0095598	Silvery flower (diploied) 1	7.758
	CNS0095599	Silvery flower (diploied) 2	4.597
	CNS0095600	Silvery flower (diploied) 3	3.945
	CNS0095601	Golden flower (diploid) 1	6.722
	CNS0095602	Golden flower (diploid) 2	4.374
	CNS0095603	Golden flower (diploid) 3	5.138
	CNS0095604	Slightly white alabastrum(tetraploid) 1	17.108
	CNS0095605	Slightly white alabastrum(tetraploid) 2	18.577
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.934
	CNS0095607	Whole white alabastrum(tetraploid) 1	20.821
	CNS0095608	Whole white alabastrum(tetraploid) 2	21.012
	CNS0095609	Whole white alabastrum(tetraploid) 3	12.135
	CNS0095610	Silvery flower (tetraploid) 1	6.091
	CNS0095611	Silvery flower (tetraploid) 2	3.740
	CNS0095612	Silvery flower (tetraploid) 3	4.230
	CNS0095613	Golden flower (tetraploid) 1	4.726
	CNS0095614	Golden flower (tetraploid) 2	7.450
	CNS0095615	Golden flower (tetraploid) 3	3.393
CRA001975	CRR073297	Stem 1	8.530
	CRR073298	Stem 2	7.095
	CRR073299	Stem 3	8.408
	CRR073300	Leaf 1	11.972
	CRR073301	Leaf 2	11.757
	CRR073302	Leaf 3	7.939
	CRR073303	Juvenile bud 1	5.114
	CRR073304	Juvenile bud 2	3.955
	CRR073305	Juvenile bud 3	3.890
	CRR073306	Third green 1	0.436
	CRR073307	Third green 2	1.158
	CRR073308	Third green 3	1.679
	CRR073309	Second white 1	1.144
	CRR073310	Second white 2	1.898
	CRR073311	Second white 3	1.037
	CRR073312	Silver flowering 1	1.612
	CRR073313	Silver flowering 2	1.112
	CRR073314	Silver flowering 3	0.615
	CRR073315	Gold flowering 1	3.143
	CRR073316	Gold flowering 2	5.990
	CRR073317	Gold flowering 3	2.477
	CRR073318	Tawny withering 1	4.959
	CRR073319	Tawny withering 2	7.505
	CRR073320	Tawny withering 3	6.253