Gene detail

Detail information of GWHGAAZE025036

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP09489.1	8.70579E-70	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q8GXL3\|SPL8_ARATH	8E-51	Squamosa promoter-binding-like protein 8
trEMBL	tr\|A0A068UMK9\|A0A068UMK9_COFCA	3E-70	Coffea canephora DH200=94 genomic scaffold, scaffold_38 {ECO:0000313\|EMBL:CDP09489.1}
TAIR10	AT1G02065.2	1E-42	squamosa promoter binding protein-like 8

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	53998158	53998793	-
GWHAAZE00000007	mRNA	53998158	53998793	-
GWHAAZE00000007	exon	53998158	53998793	-
GWHAAZE00000007	CDS	53998158	53998793	-

Transcript Sequence
>GWHTAAZE025070 ATGTTGGAATATGATTGGGGAAACCCATCTCCGATCATGCTCACCGGCTTCGATTCTGACGACCCGACCCGCCAGACCGACCAACAAACCCGGCTCGTTTTCGAACCCTACACCCAACAAACCTTCAGCGAACCACTCATTAACCAAACCGGGTTCAACCCGCAAACCCACCACTACCAGCCACAGGCGTATGACCCACGCGCCTTCTGCTCTGCGTATGATCCACGCGCCTTCTGCTCTGGTTATCCGCCGCCGCCGCCATCCGTGATTTCATTCGAACCGGCTGGTCCAATCTGTCCGACTGAGTTCGTAAAGAGTGAACCGGGCGGTTCGAGTAGGATAGGGTTGAACTTGGGGGGGCGGACCTATTTTTCTTCCTCGGAGGATGATTTTGTGAACCGGCTTTACCAGGCGTCTAGACCGGTAGAGTCGGGTTCAGTTAATTCACCGAGGTGTCAAGCCGAGGGGTGTAATGCCGATCTTACCGACGCAAAGCATTACCACCGAAGGCATAAGGTTTGTGAGTTTCACTCCAAAGCTTCGACCGTCGTTGCCGCCGGTTTGACTCAACGGTTCTGTCAACAGTGCAGCAGGTTTGTGTTAAATTACGATAGTACCCTCTCCGTTGGACCTTAG

Network for GWHGAAZE025036

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0266

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03110.15	SBP	152	199	2.10E-18

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	SBP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005634	cellular_component	nucleus
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	8.511
	SRR3591706	second leaf	3.047
	SRR3591707	mature leaf	0.194
	SRR3591708	Shoot apex	20.597
	SRR3591709	Stem	2.353
	SRR3591710	White floral bud	8.920
	SRR3591711	White flower	10.162
	SRR3591712	Green floral bud	2.150
	SRR3591713	Yellow flower	1.512
SRP173429	SRR8316895	Juvenile bud stage	6.558
	SRR8316896	Juvenile bud stage	3.658
	SRR8316897	Juvenile bud stage	1.636
	SRR8316894	Third green stage	3.249
	SRR8316900	Third green stage	0.995
	SRR8316901	Third green stage	1.751
	SRR8316898	Complete white stage	1.073
	SRR8316899	Complete white stage	21.813
	SRR8316903	Complete white stage	6.348
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.050
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.050
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.191
SRP132670	SRR6706286	Control	6.546
	SRR6706287	Light intensity 50%	7.520
	SRR6706288	Light intensity 20%	6.845
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	9.008
	CNS0095593	Slightly white alabastrum(diploid) 2	11.739
	CNS0095594	Slightly white alabastrum(diploid) 3	6.207
	CNS0095595	Whole white alabastrum(diploid) 2	10.824
	CNS0095596	Whole white alabastrum(diploid) 3	0.757
	CNS0095597	Whole white alabastrum(diploid) 4	8.840
	CNS0095598	Silvery flower (diploied) 1	60.533
	CNS0095599	Silvery flower (diploied) 2	52.369
	CNS0095600	Silvery flower (diploied) 3	16.145
	CNS0095601	Golden flower (diploid) 1	53.898
	CNS0095602	Golden flower (diploid) 2	30.482
	CNS0095603	Golden flower (diploid) 3	31.703
	CNS0095604	Slightly white alabastrum(tetraploid) 1	9.961
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.275
	CNS0095606	Slightly white alabastrum(tetraploid) 3	21.451
	CNS0095607	Whole white alabastrum(tetraploid) 1	13.661
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.540
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.616
	CNS0095610	Silvery flower (tetraploid) 1	2.333
	CNS0095611	Silvery flower (tetraploid) 2	13.679
	CNS0095612	Silvery flower (tetraploid) 3	5.217
	CNS0095613	Golden flower (tetraploid) 1	1.117
	CNS0095614	Golden flower (tetraploid) 2	2.620
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	12.204
	CRR073298	Stem 2	13.226
	CRR073299	Stem 3	17.648
	CRR073300	Leaf 1	3.529
	CRR073301	Leaf 2	2.065
	CRR073302	Leaf 3	2.698
	CRR073303	Juvenile bud 1	2.561
	CRR073304	Juvenile bud 2	0.934
	CRR073305	Juvenile bud 3	3.965
	CRR073306	Third green 1	0.073
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.479
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.211
	CRR073316	Gold flowering 2	0.973
	CRR073317	Gold flowering 3	0.334
	CRR073318	Tawny withering 1	0.461
	CRR073319	Tawny withering 2	2.543
	CRR073320	Tawny withering 3	0.577