Gene detail

Detail information of GWHGAAZE025107

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU40312.1	2.4993E-115	hypothetical protein MIMGU_mgv1a013671mg [Erythranthe guttata]
COG	NP_868424.1	3E-36	uridylate kinase
Swissprot	tr\|O04905\|KCY3_ARATH	6E-110	UMP-CMP kinase 3 {ECO:0000255\|HAMAP-Rule:MF_03172}
trEMBL	tr\|A0A022RIQ9\|A0A022RIQ9_ERYGU	9E-116	UMP-CMP kinase {ECO:0000256\|HAMAP-Rule:MF_03172}
TAIR10	AT5G26667.1	5E-88	P-loop containing nucleoside triphosphate hydrolases superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	55250586	55254527	+
GWHAAZE00000007	mRNA	55250586	55254527	+
GWHAAZE00000007	exon	55250586	55250637	+
GWHAAZE00000007	exon	55251475	55251592	+
GWHAAZE00000007	exon	55252822	55252978	+
GWHAAZE00000007	exon	55254011	55254091	+
GWHAAZE00000007	exon	55254243	55254350	+
GWHAAZE00000007	exon	55254435	55254527	+
GWHAAZE00000007	CDS	55250586	55250637	+
GWHAAZE00000007	CDS	55251475	55251592	+
GWHAAZE00000007	CDS	55252822	55252978	+
GWHAAZE00000007	CDS	55254011	55254091	+
GWHAAZE00000007	CDS	55254243	55254350	+
GWHAAZE00000007	CDS	55254435	55254527	+

Transcript Sequence
>GWHTAAZE025141 ATGAGTAACTGCTGTTGCCATCACCAGCATCCTGGTTTACCTGAAAGTGTTGGTGGCCCGGGCAGTGGTAAGGGTACCCAGTGTGCGAATATTGTGAAGAACTATGGATACACCCATCTCAGTGCTGGTGATCTTCTCCGCGCAGAAATAAAATCTGGTTCTGAAAATGGGACCATGATTCAGAACATGATTAAGGAAGGAAAGATCGTTCCTTCGGAGGTAACAATTAAGCTTCTTCAAAAAGCAATATTGGAAGATGGTAATGACAAATTTCTAATTGATGGCTTTCCTCGCAATGAGGAAAATCGTGCAGCTTTTGAGTCTGTTACCGGAATTGAACCAGAGTTTGTCCTTTTTTTTGAGTGTTCGGAAGAAGAAATGGAGAGGCGCCTTTTGGGCCGGAATCAGGGAAGAGAAGATGATAACATCGAAACAATAAGGAAGCGGTTTAAGGTTTACATGGAATCTAGTCTCCCTGTAATCGAGTATTACAATGCCAAGGAGAAAGTCCGAAAGATTGATGCTGCGAAGCCCATCGAGGAAGTTTTCGAAGCTGTCAAGGCTGTTTTTGCTCCTTTGCATGCCAAGGTAAAGCTAGAAAAGAATTGA

Network for GWHGAAZE025107

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00406.23	ADK	17	168	3.80E-49

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13800	CMPK1, UMPK	Metabolic pathways	map01100
		Pyrimidine metabolism	map00240
		Drug metabolism - other enzymes	map00983

Gene Ontology

GO term	Ontology	Name
GO:0006139	biological_process	nucleobase-containing compound metabolic process
GO:0006207	biological_process	'de novo' pyrimidine nucleobase biosynthetic process
GO:0006221	biological_process	pyrimidine nucleotide biosynthetic process
GO:0005524	molecular_function	ATP binding
GO:0019205	molecular_function	nucleobase-containing compound kinase activity
GO:0004127	molecular_function	cytidylate kinase activity
GO:0009041	molecular_function	uridylate kinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	389.708
	SRR3591706	second leaf	76.620
	SRR3591707	mature leaf	60.616
	SRR3591708	Shoot apex	110.794
	SRR3591709	Stem	272.166
	SRR3591710	White floral bud	211.635
	SRR3591711	White flower	222.942
	SRR3591712	Green floral bud	276.361
	SRR3591713	Yellow flower	177.990
SRP173429	SRR8316895	Juvenile bud stage	113.816
	SRR8316896	Juvenile bud stage	155.968
	SRR8316897	Juvenile bud stage	90.946
	SRR8316894	Third green stage	69.404
	SRR8316900	Third green stage	281.872
	SRR8316901	Third green stage	278.157
	SRR8316898	Complete white stage	176.020
	SRR8316899	Complete white stage	359.704
	SRR8316903	Complete white stage	206.604
	SRR8316902	Silver flowering stage	153.779
	SRR8316904	Silver flowering stage	174.831
	SRR8316905	Silver flowering stage	77.205
	SRR8316906	Gold flowering stage	210.114
	SRR8316907	Gold flowering stage	197.456
	SRR8316908	Gold flowering stage	223.241
SRP132670	SRR6706286	Control	131.261
	SRR6706287	Light intensity 50%	164.349
	SRR6706288	Light intensity 20%	169.402
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	215.279
	CNS0095593	Slightly white alabastrum(diploid) 2	251.542
	CNS0095594	Slightly white alabastrum(diploid) 3	177.790
	CNS0095595	Whole white alabastrum(diploid) 2	223.160
	CNS0095596	Whole white alabastrum(diploid) 3	241.025
	CNS0095597	Whole white alabastrum(diploid) 4	214.302
	CNS0095598	Silvery flower (diploied) 1	113.212
	CNS0095599	Silvery flower (diploied) 2	126.936
	CNS0095600	Silvery flower (diploied) 3	204.378
	CNS0095601	Golden flower (diploid) 1	99.343
	CNS0095602	Golden flower (diploid) 2	155.278
	CNS0095603	Golden flower (diploid) 3	156.672
	CNS0095604	Slightly white alabastrum(tetraploid) 1	245.142
	CNS0095605	Slightly white alabastrum(tetraploid) 2	214.856
	CNS0095606	Slightly white alabastrum(tetraploid) 3	281.117
	CNS0095607	Whole white alabastrum(tetraploid) 1	236.017
	CNS0095608	Whole white alabastrum(tetraploid) 2	317.009
	CNS0095609	Whole white alabastrum(tetraploid) 3	345.156
	CNS0095610	Silvery flower (tetraploid) 1	226.264
	CNS0095611	Silvery flower (tetraploid) 2	125.668
	CNS0095612	Silvery flower (tetraploid) 3	156.164
	CNS0095613	Golden flower (tetraploid) 1	141.823
	CNS0095614	Golden flower (tetraploid) 2	177.888
	CNS0095615	Golden flower (tetraploid) 3	90.700
CRA001975	CRR073297	Stem 1	133.322
	CRR073298	Stem 2	133.104
	CRR073299	Stem 3	118.563
	CRR073300	Leaf 1	226.002
	CRR073301	Leaf 2	208.863
	CRR073302	Leaf 3	192.223
	CRR073303	Juvenile bud 1	243.814
	CRR073304	Juvenile bud 2	321.625
	CRR073305	Juvenile bud 3	193.627
	CRR073306	Third green 1	191.482
	CRR073307	Third green 2	195.794
	CRR073308	Third green 3	179.299
	CRR073309	Second white 1	273.845
	CRR073310	Second white 2	168.374
	CRR073311	Second white 3	119.792
	CRR073312	Silver flowering 1	206.749
	CRR073313	Silver flowering 2	207.693
	CRR073314	Silver flowering 3	165.561
	CRR073315	Gold flowering 1	99.088
	CRR073316	Gold flowering 2	103.642
	CRR073317	Gold flowering 3	77.847
	CRR073318	Tawny withering 1	209.275
	CRR073319	Tawny withering 2	229.277
	CRR073320	Tawny withering 3	278.648