Gene detail

Detail information of GWHGAAZE025115

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI25230.3	1.99757E-73	unnamed protein product [Vitis vinifera]
COG	YP_003950666.1	3E-25	transthyretin family protein
Swissprot	tr\|Q9LVM5\|TTHL_ARATH	7E-57	5-hydroxyisourate hydrolase
trEMBL	tr\|D7T3Z8\|D7T3Z8_VITVI	7E-74	5-hydroxyisourate hydrolase {ECO:0000256\|RuleBase:RU004307}
TAIR10	AT5G58220.1	2E-41	transthyretin-like protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	55538132	55538581	-
GWHAAZE00000007	mRNA	55538132	55538581	-
GWHAAZE00000007	exon	55538132	55538581	-
GWHAAZE00000007	CDS	55538132	55538581	-

Transcript Sequence
>GWHTAAZE025149 ATGAGCAAAATTGGAGCACATTTAACTAAAGCACCGGAAGCTTCTTTTGCAAAACCATCACAAATCCCCACTAGGACCCGCCCACCCATTACAACCCATGTCTTGGATGTTGCTCGTGGGTCCCCCGCAGCTGGCATAGAAGTACATTTGGAGATGCAGAAAACAGATCAAAACAGTTCGATTTTAAACGATAACAATACCAACCATTGGATATTACAAGGCTCCTCAACTACAGATAAAGATGGACGAAGCGGCCAGCTAATGAATATAACCGATGCTTTGAACCCTGGAATATATCGGATAAGTTTCAATACCGGAAAATACAATCCTGATGGATTTTTCCCTTATGTCTCTATTGTATTTGAGATCAGAGAGTCGCAAAAGTGGGAGCATTTTCATGTTCCATTATTGCTCTCGCCGTTTTCGTACTCTACTTATCGCGGAAGCTAA

Network for GWHGAAZE025115

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00576.22	Transthyretin	30	148	1.30E-34

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13484	TTHL	Metabolic pathways	map01100
K13484	TTHL	Purine metabolism	map00230

Gene Ontology

GO term	Ontology	Name
GO:0006144	biological_process	purine nucleobase metabolic process
GO:0033971	molecular_function	hydroxyisourate hydrolase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	22.791
	SRR3591706	second leaf	10.932
	SRR3591707	mature leaf	17.250
	SRR3591708	Shoot apex	29.844
	SRR3591709	Stem	31.189
	SRR3591710	White floral bud	22.484
	SRR3591711	White flower	27.815
	SRR3591712	Green floral bud	33.307
	SRR3591713	Yellow flower	28.692
SRP173429	SRR8316895	Juvenile bud stage	25.673
	SRR8316896	Juvenile bud stage	39.663
	SRR8316897	Juvenile bud stage	16.921
	SRR8316894	Third green stage	13.174
	SRR8316900	Third green stage	39.742
	SRR8316901	Third green stage	45.089
	SRR8316898	Complete white stage	21.435
	SRR8316899	Complete white stage	65.283
	SRR8316903	Complete white stage	22.798
	SRR8316902	Silver flowering stage	18.137
	SRR8316904	Silver flowering stage	19.769
	SRR8316905	Silver flowering stage	7.535
	SRR8316906	Gold flowering stage	31.044
	SRR8316907	Gold flowering stage	26.085
	SRR8316908	Gold flowering stage	22.888
SRP132670	SRR6706286	Control	40.524
	SRR6706287	Light intensity 50%	36.397
	SRR6706288	Light intensity 20%	38.489
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	32.829
	CNS0095593	Slightly white alabastrum(diploid) 2	40.922
	CNS0095594	Slightly white alabastrum(diploid) 3	36.735
	CNS0095595	Whole white alabastrum(diploid) 2	24.618
	CNS0095596	Whole white alabastrum(diploid) 3	31.522
	CNS0095597	Whole white alabastrum(diploid) 4	33.006
	CNS0095598	Silvery flower (diploied) 1	33.447
	CNS0095599	Silvery flower (diploied) 2	34.810
	CNS0095600	Silvery flower (diploied) 3	39.923
	CNS0095601	Golden flower (diploid) 1	36.819
	CNS0095602	Golden flower (diploid) 2	34.139
	CNS0095603	Golden flower (diploid) 3	35.764
	CNS0095604	Slightly white alabastrum(tetraploid) 1	35.294
	CNS0095605	Slightly white alabastrum(tetraploid) 2	27.953
	CNS0095606	Slightly white alabastrum(tetraploid) 3	42.220
	CNS0095607	Whole white alabastrum(tetraploid) 1	18.879
	CNS0095608	Whole white alabastrum(tetraploid) 2	26.144
	CNS0095609	Whole white alabastrum(tetraploid) 3	30.087
	CNS0095610	Silvery flower (tetraploid) 1	39.295
	CNS0095611	Silvery flower (tetraploid) 2	33.747
	CNS0095612	Silvery flower (tetraploid) 3	20.963
	CNS0095613	Golden flower (tetraploid) 1	27.323
	CNS0095614	Golden flower (tetraploid) 2	31.003
	CNS0095615	Golden flower (tetraploid) 3	21.368
CRA001975	CRR073297	Stem 1	33.105
	CRR073298	Stem 2	31.416
	CRR073299	Stem 3	28.149
	CRR073300	Leaf 1	37.657
	CRR073301	Leaf 2	41.741
	CRR073302	Leaf 3	31.956
	CRR073303	Juvenile bud 1	39.792
	CRR073304	Juvenile bud 2	25.915
	CRR073305	Juvenile bud 3	33.483
	CRR073306	Third green 1	5.408
	CRR073307	Third green 2	8.356
	CRR073308	Third green 3	9.714
	CRR073309	Second white 1	3.656
	CRR073310	Second white 2	11.866
	CRR073311	Second white 3	9.064
	CRR073312	Silver flowering 1	6.627
	CRR073313	Silver flowering 2	5.575
	CRR073314	Silver flowering 3	12.312
	CRR073315	Gold flowering 1	19.532
	CRR073316	Gold flowering 2	29.123
	CRR073317	Gold flowering 3	18.245
	CRR073318	Tawny withering 1	32.600
	CRR073319	Tawny withering 2	46.431
	CRR073320	Tawny withering 3	32.410