Gene detail

Detail information of GWHGAAZE025277

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006446454.1	2.05007E-84	hypothetical protein CICLE_v10018163mg [Citrus clementina]
COG	YP_008797956.1	2E-12	ubiquitin-conjugating enzyme E2-like protein
Swissprot	tr\|P42749\|UBC5_ARATH	4E-67	Ubiquitin-conjugating enzyme E2 5
trEMBL	tr\|V4W1G2\|V4W1G2_9ROSI	8E-85	Uncharacterized protein {ECO:0000313\|EMBL:ESR59694.1}
TAIR10	AT1G63800.1	4E-51	ubiquitin-conjugating enzyme 5

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	58931595	58934415	+
GWHAAZE00000007	mRNA	58931595	58934415	+
GWHAAZE00000007	exon	58931595	58931743	+
GWHAAZE00000007	exon	58932424	58932476	+
GWHAAZE00000007	exon	58933296	58933460	+
GWHAAZE00000007	exon	58934273	58934415	+
GWHAAZE00000007	CDS	58931595	58931743	+
GWHAAZE00000007	CDS	58932424	58932476	+
GWHAAZE00000007	CDS	58933296	58933460	+
GWHAAZE00000007	CDS	58934273	58934415	+

Transcript Sequence
>GWHTAAZE025311 ATGTACCTTACTGATTCGATCGCATTGGCTGCAGGTCTTTATGAAGGTGGTGTCTGGAAAGTTCGTGTGGAGCTTCCCGATGCTTATCCTTACAAGTCTCCTTCAATTGGGTTTCTTAACAAGATATTCCACCCAAATGTTGATGAGCTGTCTGGGTCTGTTTGCTTGGATGTCATAAATCAATCATGGAGCCCAATGTTTGTCCACCAGTATCTTACAAAAGTGAATACTCATGCAGATCTTTTGAATGTGTTCGAGGTTTTCCTTCCTCAACTTTTGCTTTACCCGAATCCATCAGATCCATTAAATGGCGATGCAGCATCATTGATGATGAAGGATCGGAAGCAGTATGAACAAAAAGTGAAAGAGTACTGCGATCGATATGCGAAGAAGGAAAACATAACGAGCACGCCTACAGAAGACAGTGATGATGAGGTAAGCGACGATGACATCAGCGATGGACGAAGTGCATCTAGTGAGGATGATGTGGCTCGACATGCGGACCCATAA

Network for GWHGAAZE025277

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00179.27	UQ_con	11	124	1.70E-28

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	UBC

KEGG pathway

KO	Enzyme	pathway	mapID
K10576	UBE2H, UBC8	Ubiquitin mediated proteolysis	map04120

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	61.382
	SRR3591706	second leaf	32.362
	SRR3591707	mature leaf	21.450
	SRR3591708	Shoot apex	45.511
	SRR3591709	Stem	56.863
	SRR3591710	White floral bud	71.433
	SRR3591711	White flower	67.730
	SRR3591712	Green floral bud	64.263
	SRR3591713	Yellow flower	60.403
SRP173429	SRR8316895	Juvenile bud stage	28.853
	SRR8316896	Juvenile bud stage	50.345
	SRR8316897	Juvenile bud stage	21.715
	SRR8316894	Third green stage	20.900
	SRR8316900	Third green stage	66.578
	SRR8316901	Third green stage	63.832
	SRR8316898	Complete white stage	50.489
	SRR8316899	Complete white stage	80.400
	SRR8316903	Complete white stage	65.307
	SRR8316902	Silver flowering stage	40.571
	SRR8316904	Silver flowering stage	55.055
	SRR8316905	Silver flowering stage	23.463
	SRR8316906	Gold flowering stage	77.568
	SRR8316907	Gold flowering stage	76.502
	SRR8316908	Gold flowering stage	66.321
SRP132670	SRR6706286	Control	33.032
	SRR6706287	Light intensity 50%	33.874
	SRR6706288	Light intensity 20%	36.070
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	39.581
	CNS0095593	Slightly white alabastrum(diploid) 2	38.952
	CNS0095594	Slightly white alabastrum(diploid) 3	44.911
	CNS0095595	Whole white alabastrum(diploid) 2	43.636
	CNS0095596	Whole white alabastrum(diploid) 3	61.698
	CNS0095597	Whole white alabastrum(diploid) 4	45.605
	CNS0095598	Silvery flower (diploied) 1	33.425
	CNS0095599	Silvery flower (diploied) 2	36.452
	CNS0095600	Silvery flower (diploied) 3	58.806
	CNS0095601	Golden flower (diploid) 1	38.134
	CNS0095602	Golden flower (diploid) 2	53.472
	CNS0095603	Golden flower (diploid) 3	54.701
	CNS0095604	Slightly white alabastrum(tetraploid) 1	45.199
	CNS0095605	Slightly white alabastrum(tetraploid) 2	40.388
	CNS0095606	Slightly white alabastrum(tetraploid) 3	48.595
	CNS0095607	Whole white alabastrum(tetraploid) 1	48.211
	CNS0095608	Whole white alabastrum(tetraploid) 2	40.903
	CNS0095609	Whole white alabastrum(tetraploid) 3	52.222
	CNS0095610	Silvery flower (tetraploid) 1	55.334
	CNS0095611	Silvery flower (tetraploid) 2	52.141
	CNS0095612	Silvery flower (tetraploid) 3	56.739
	CNS0095613	Golden flower (tetraploid) 1	41.705
	CNS0095614	Golden flower (tetraploid) 2	59.298
	CNS0095615	Golden flower (tetraploid) 3	55.675
CRA001975	CRR073297	Stem 1	40.618
	CRR073298	Stem 2	39.410
	CRR073299	Stem 3	32.213
	CRR073300	Leaf 1	47.402
	CRR073301	Leaf 2	36.753
	CRR073302	Leaf 3	47.199
	CRR073303	Juvenile bud 1	48.296
	CRR073304	Juvenile bud 2	51.069
	CRR073305	Juvenile bud 3	28.394
	CRR073306	Third green 1	42.468
	CRR073307	Third green 2	60.967
	CRR073308	Third green 3	41.610
	CRR073309	Second white 1	52.788
	CRR073310	Second white 2	55.380
	CRR073311	Second white 3	41.153
	CRR073312	Silver flowering 1	47.779
	CRR073313	Silver flowering 2	50.033
	CRR073314	Silver flowering 3	38.790
	CRR073315	Gold flowering 1	24.595
	CRR073316	Gold flowering 2	32.728
	CRR073317	Gold flowering 3	20.383
	CRR073318	Tawny withering 1	31.558
	CRR073319	Tawny withering 2	41.933
	CRR073320	Tawny withering 3	32.833