Gene detail

Detail information of GWHGAAZE025420

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010660789.1	1.82482E-26	PREDICTED: sister chromatid cohesion 1 protein 2 isoform X1 [Vitis vinifera]
Swissprot	tr\|Q9FQ20\|SCC12_ARATH	3E-14	Sister chromatid cohesion 1 protein 2
trEMBL	tr\|D7UBE8\|D7UBE8_VITVI	4E-26	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI40063.3}
TAIR10	AT5G40840.1	5E-13	Rad21/Rec8-like family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	60958298	60959697	+
GWHAAZE00000007	mRNA	60958298	60959697	+
GWHAAZE00000007	exon	60958298	60958322	+
GWHAAZE00000007	exon	60959130	60959415	+
GWHAAZE00000007	exon	60959508	60959545	+
GWHAAZE00000007	exon	60959633	60959697	+
GWHAAZE00000007	CDS	60958298	60958322	+
GWHAAZE00000007	CDS	60959130	60959415	+
GWHAAZE00000007	CDS	60959508	60959545	+
GWHAAZE00000007	CDS	60959633	60959697	+

Transcript Sequence
>GWHTAAZE025454 ATGATGTTGGATGAAAAAGAGGCAGTCGCTTTGTTTCATTCAGATAAAATTTTGGTCGATGTACCTGTTGTCACATACAGAATCTTGGGATACCTTCTTCTGGGTATCGTGAGAATATACTCTAAGAAAGTCGAGTATCTAGAACATGATTGTCGCAGTGTGATGACTAAAATTTCTGACTTTTCGGTGAGTAAAAAAGCTACTGCTCCTCCTGTGGAAGTGATGGGAATTCCTTTTTATTCTTCTATCACACTCCCTGCGACGTTTGAACTTGACGCTTTTGATCTAGAAGTCTCAGATTGTGCAAGCTGTGAACACATGAAATCTAGTACAGATATCATACTTGAAGGGAAGAATGAGGGAATCGGGACCCACTCATTTGCCAAGGTATGCATTATTGCAGCTCAGCATTAA

Network for GWHGAAZE025420

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04825.14	Rad21_Rec8_N	24	65	9.80E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K06670	SCC1, MCD1, RAD21	Cell cycle	map04110
K06670	SCC1, MCD1, RAD21	Cell cycle - yeast	map04111

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.466
	SRR3591706	second leaf	1.743
	SRR3591707	mature leaf	0.714
	SRR3591708	Shoot apex	2.665
	SRR3591709	Stem	4.649
	SRR3591710	White floral bud	2.660
	SRR3591711	White flower	2.197
	SRR3591712	Green floral bud	1.707
	SRR3591713	Yellow flower	0.402
SRP173429	SRR8316895	Juvenile bud stage	1.707
	SRR8316896	Juvenile bud stage	0.888
	SRR8316897	Juvenile bud stage	0.900
	SRR8316894	Third green stage	0.815
	SRR8316900	Third green stage	1.578
	SRR8316901	Third green stage	0.937
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	1.797
	SRR8316903	Complete white stage	0.431
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.180
	SRR8316905	Silver flowering stage	0.155
	SRR8316906	Gold flowering stage	0.280
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.211
SRP132670	SRR6706286	Control	0.046
	SRR6706287	Light intensity 50%	0.275
	SRR6706288	Light intensity 20%	0.077
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.131
	CNS0095593	Slightly white alabastrum(diploid) 2	0.199
	CNS0095594	Slightly white alabastrum(diploid) 3	0.189
	CNS0095595	Whole white alabastrum(diploid) 2	0.963
	CNS0095596	Whole white alabastrum(diploid) 3	0.506
	CNS0095597	Whole white alabastrum(diploid) 4	0.739
	CNS0095598	Silvery flower (diploied) 1	1.473
	CNS0095599	Silvery flower (diploied) 2	3.017
	CNS0095600	Silvery flower (diploied) 3	0.220
	CNS0095601	Golden flower (diploid) 1	1.781
	CNS0095602	Golden flower (diploid) 2	2.180
	CNS0095603	Golden flower (diploid) 3	1.137
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.598
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.449
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.123
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.025
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.504
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.139
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.136
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.066
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.123
CRA001975	CRR073297	Stem 1	0.820
	CRR073298	Stem 2	0.903
	CRR073299	Stem 3	0.280
	CRR073300	Leaf 1	0.195
	CRR073301	Leaf 2	0.912
	CRR073302	Leaf 3	0.362
	CRR073303	Juvenile bud 1	0.043
	CRR073304	Juvenile bud 2	0.121
	CRR073305	Juvenile bud 3	0.111
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.046
	CRR073308	Third green 3	0.095
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.403
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.166
	CRR073316	Gold flowering 2	0.694
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	1.536
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.200