Gene detail

Detail information of GWHGAAZE025425

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU45414.1	4.7541E-99	hypothetical protein MIMGU_mgv1a014411mg [Erythranthe guttata]
COG	YP_001356699.1	6E-38	50S ribosomal protein L27
Swissprot	tr\|P30155\|RK27_TOBAC	3E-86	50S ribosomal protein L27, chloroplastic (Precursor)
trEMBL	tr\|A0A022RZD3\|A0A022RZD3_ERYGU	2E-99	Uncharacterized protein {ECO:0000313\|EMBL:EYU45414.1}
TAIR10	AT5G40950.1	9E-65	ribosomal protein large subunit 27

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	60996058	60998761	+
GWHAAZE00000007	mRNA	60996058	60998761	+
GWHAAZE00000007	exon	60996058	60996351	+
GWHAAZE00000007	exon	60998368	60998469	+
GWHAAZE00000007	exon	60998579	60998761	+
GWHAAZE00000007	CDS	60996058	60996351	+
GWHAAZE00000007	CDS	60998368	60998469	+
GWHAAZE00000007	CDS	60998579	60998761	+

Transcript Sequence
>GWHTAAZE025459 ATGGCGGCCACAGCTATGAGCTTCAATCTAATTGGAGCTTTTACAGGACTTTCTGTAGGTTCCAGCTCTTCTTCCTCTTTCTTCAGAGGAGATTTTAGTTCCATTCACGTTGGCCACAAGCTCTCCGTTTCTTTTCCCTTGAAATCGCCATTAACTATCGAGTCTGCTCACAAGAAAGGGGCTGGAAGTACGAAGAATGGAAGAGATTCCAAAGGACAGAGGCTTGGGGTTAAGATTTATGGCGATCAGCTTGCCAAGCCCGGTGCCATTATCATACGTCAGCGTGGAACTAAGGTTCATCCGGGGAATAATGTTGGGATTGGCAAAGATCACACCATCTTCTCTTTAATTGATGGATTGGTCAAGTTTGAAAAGTTTGGTCCTGACAGAAAGAAGGTGAGTGTATATCCATACGAAAAACAGCCTGAAAACCCAAATAGTTACAGAGCAAGAAAGAGAGAAGCCTTCAGACTACAGCGTGAGCGCAAGAAAGCAAGAAAGGAAGGCTTTGTTGGTCAGCCTCAGCTAGTACTCGCTTCGGCTGCTGATACTACTACGGACAACAATCCAGTCTGCTGA

Network for GWHGAAZE025425

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01016.20	Ribosomal_L27	56	135	3.50E-36

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02899	RP-L27, MRPL27, rpmA	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	291.267
	SRR3591706	second leaf	490.046
	SRR3591707	mature leaf	480.410
	SRR3591708	Shoot apex	516.223
	SRR3591709	Stem	188.375
	SRR3591710	White floral bud	192.399
	SRR3591711	White flower	188.874
	SRR3591712	Green floral bud	294.668
	SRR3591713	Yellow flower	228.719
SRP173429	SRR8316895	Juvenile bud stage	153.370
	SRR8316896	Juvenile bud stage	175.134
	SRR8316897	Juvenile bud stage	113.377
	SRR8316894	Third green stage	84.871
	SRR8316900	Third green stage	275.107
	SRR8316901	Third green stage	234.905
	SRR8316898	Complete white stage	96.155
	SRR8316899	Complete white stage	259.936
	SRR8316903	Complete white stage	116.156
	SRR8316902	Silver flowering stage	89.834
	SRR8316904	Silver flowering stage	97.657
	SRR8316905	Silver flowering stage	66.812
	SRR8316906	Gold flowering stage	192.039
	SRR8316907	Gold flowering stage	195.812
	SRR8316908	Gold flowering stage	193.699
SRP132670	SRR6706286	Control	365.261
	SRR6706287	Light intensity 50%	359.917
	SRR6706288	Light intensity 20%	411.357
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	236.165
	CNS0095593	Slightly white alabastrum(diploid) 2	225.033
	CNS0095594	Slightly white alabastrum(diploid) 3	179.955
	CNS0095595	Whole white alabastrum(diploid) 2	227.318
	CNS0095596	Whole white alabastrum(diploid) 3	264.321
	CNS0095597	Whole white alabastrum(diploid) 4	186.086
	CNS0095598	Silvery flower (diploied) 1	260.288
	CNS0095599	Silvery flower (diploied) 2	221.728
	CNS0095600	Silvery flower (diploied) 3	207.308
	CNS0095601	Golden flower (diploid) 1	240.083
	CNS0095602	Golden flower (diploid) 2	193.953
	CNS0095603	Golden flower (diploid) 3	199.446
	CNS0095604	Slightly white alabastrum(tetraploid) 1	214.539
	CNS0095605	Slightly white alabastrum(tetraploid) 2	220.831
	CNS0095606	Slightly white alabastrum(tetraploid) 3	312.764
	CNS0095607	Whole white alabastrum(tetraploid) 1	141.770
	CNS0095608	Whole white alabastrum(tetraploid) 2	191.696
	CNS0095609	Whole white alabastrum(tetraploid) 3	305.981
	CNS0095610	Silvery flower (tetraploid) 1	215.392
	CNS0095611	Silvery flower (tetraploid) 2	233.083
	CNS0095612	Silvery flower (tetraploid) 3	218.662
	CNS0095613	Golden flower (tetraploid) 1	207.811
	CNS0095614	Golden flower (tetraploid) 2	202.759
	CNS0095615	Golden flower (tetraploid) 3	214.403
CRA001975	CRR073297	Stem 1	228.383
	CRR073298	Stem 2	202.524
	CRR073299	Stem 3	274.993
	CRR073300	Leaf 1	190.672
	CRR073301	Leaf 2	207.390
	CRR073302	Leaf 3	241.250
	CRR073303	Juvenile bud 1	243.962
	CRR073304	Juvenile bud 2	282.237
	CRR073305	Juvenile bud 3	169.248
	CRR073306	Third green 1	228.201
	CRR073307	Third green 2	192.837
	CRR073308	Third green 3	171.900
	CRR073309	Second white 1	254.858
	CRR073310	Second white 2	157.619
	CRR073311	Second white 3	137.818
	CRR073312	Silver flowering 1	156.034
	CRR073313	Silver flowering 2	180.989
	CRR073314	Silver flowering 3	122.206
	CRR073315	Gold flowering 1	694.170
	CRR073316	Gold flowering 2	588.110
	CRR073317	Gold flowering 3	514.869
	CRR073318	Tawny withering 1	128.399
	CRR073319	Tawny withering 2	118.159
	CRR073320	Tawny withering 3	124.420