Gene detail

Detail information of GWHGAAZE025426

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002274131.2	0	PREDICTED: peroxidase 55-like [Vitis vinifera]
Swissprot	tr\|Q96509\|PER55_ARATH	2E-146	Peroxidase 55 (Precursor)
trEMBL	tr\|A0A061ED21\|A0A061ED21_THECC	0	Peroxidase superfamily protein {ECO:0000313\|EMBL:EOY02826.1}
TAIR10	AT5G14130.1	1E-117	Peroxidase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	61009113	61010367	+
GWHAAZE00000007	mRNA	61009113	61010367	+
GWHAAZE00000007	exon	61009113	61009286	+
GWHAAZE00000007	exon	61009369	61009560	+
GWHAAZE00000007	exon	61009792	61010367	+
GWHAAZE00000007	CDS	61009113	61009286	+
GWHAAZE00000007	CDS	61009369	61009560	+
GWHAAZE00000007	CDS	61009792	61010367	+

Transcript Sequence
>GWHTAAZE025460 ATGGTGGTGATTCTTATGGGGAGGGCAGATGGGCAATTGGCGGCGAATTTCTATGGTTCAAGTTGTCCAAATGTCGAAAGCATAGTGAAGCAGGCCGTGTCCACAAAATTCAGCCAGACTTTCACCACAATCCCGGCCACTCTTCGTCTCTTTTTCCATGATTGCTTCGTCGAGGGATGTGATGCATCGGTGCTTATTTCGTCACCAAATGGGGATGCAGAAAAGGATTCTCAAGACAATCTTTCGCTAGCAGGAGACGGATTCGACACTGTGATCAAGGCGAAACAAGCAGTAGAGGGAATATGCCCTGGGGTAGTATCATGTGCAGACATTTTGGCTATTGCTACCAGAGATGTTGTAGTTCTGGCTGGAGGACCTTCATTTCCCGTAGAATTGGGACGTCGGGACGGGCTCATCTCACAGGCATCTCGGGTGGCTGGAAACCTGCCCGAACCGTTCTTCAATCTCAACCAACTAAACTCCATGTTTGCAAAGCACAACCTCACCCAATTTGACATGATCGCGCTTTCTGGGGCCCACACGCTCGGCTTTTCACACTGCAACCGCTTTGCTAACCGACTCTACTCATTTTCCTCGTCCTCGCCTGTGGACCCCACCCTGGATCAGACCTATGCTCAGCAGTTAATGGCAGCTTGCCCTCAAAATGTGGACCCCAGCATAGCTATTGATATGGATCCAGTGACCCCACAAACTTTCGACAACGTTTATTACCAGAATCTTGTTGGTGGGAAGGGTTTGTTCACTTCGGATGAGGTTCTCTTTACTAATCCGGCTTCTCAGCCTACTGTTAATGATTTCGCTACTAACCCGGGCGACTTTAACGGAGCCTTTATCACTGCAATGAGGAAGCTTGGACGGGTAGGCGTTAAAACTGGTAACCAAGGAGAGATAAGGACAGATTGTACGGCTTTCAATTCTTGA

Network for GWHGAAZE025426

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00141.24	peroxidase	29	276	3.10E-72

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00430	E1.11.1.7	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Phenylpropanoid biosynthesis	map00940

Gene Ontology

GO term	Ontology	Name
GO:0042744	biological_process	hydrogen peroxide catabolic process
GO:0006979	biological_process	response to oxidative stress
GO:0055114	biological_process	oxidation-reduction process
GO:0004601	molecular_function	peroxidase activity
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.531
	SRR3591706	second leaf	1.214
	SRR3591707	mature leaf	3.846
	SRR3591708	Shoot apex	1.607
	SRR3591709	Stem	3.762
	SRR3591710	White floral bud	2.681
	SRR3591711	White flower	2.700
	SRR3591712	Green floral bud	1.305
	SRR3591713	Yellow flower	9.710
SRP173429	SRR8316895	Juvenile bud stage	0.124
	SRR8316896	Juvenile bud stage	0.408
	SRR8316897	Juvenile bud stage	0.308
	SRR8316894	Third green stage	0.036
	SRR8316900	Third green stage	0.461
	SRR8316901	Third green stage	0.338
	SRR8316898	Complete white stage	0.955
	SRR8316899	Complete white stage	1.431
	SRR8316903	Complete white stage	0.855
	SRR8316902	Silver flowering stage	1.487
	SRR8316904	Silver flowering stage	1.732
	SRR8316905	Silver flowering stage	0.784
	SRR8316906	Gold flowering stage	17.808
	SRR8316907	Gold flowering stage	13.227
	SRR8316908	Gold flowering stage	31.011
SRP132670	SRR6706286	Control	1.376
	SRR6706287	Light intensity 50%	1.363
	SRR6706288	Light intensity 20%	1.379
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.983
	CNS0095593	Slightly white alabastrum(diploid) 2	1.305
	CNS0095594	Slightly white alabastrum(diploid) 3	1.097
	CNS0095595	Whole white alabastrum(diploid) 2	0.452
	CNS0095596	Whole white alabastrum(diploid) 3	0.649
	CNS0095597	Whole white alabastrum(diploid) 4	0.830
	CNS0095598	Silvery flower (diploied) 1	1.458
	CNS0095599	Silvery flower (diploied) 2	1.094
	CNS0095600	Silvery flower (diploied) 3	1.167
	CNS0095601	Golden flower (diploid) 1	2.034
	CNS0095602	Golden flower (diploid) 2	3.308
	CNS0095603	Golden flower (diploid) 3	3.173
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.394
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.250
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.540
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.505
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.279
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.927
	CNS0095610	Silvery flower (tetraploid) 1	1.853
	CNS0095611	Silvery flower (tetraploid) 2	0.716
	CNS0095612	Silvery flower (tetraploid) 3	4.399
	CNS0095613	Golden flower (tetraploid) 1	29.123
	CNS0095614	Golden flower (tetraploid) 2	11.548
	CNS0095615	Golden flower (tetraploid) 3	2.986
CRA001975	CRR073297	Stem 1	0.422
	CRR073298	Stem 2	0.386
	CRR073299	Stem 3	0.402
	CRR073300	Leaf 1	0.544
	CRR073301	Leaf 2	0.814
	CRR073302	Leaf 3	0.332
	CRR073303	Juvenile bud 1	0.693
	CRR073304	Juvenile bud 2	0.301
	CRR073305	Juvenile bud 3	0.772
	CRR073306	Third green 1	0.850
	CRR073307	Third green 2	0.527
	CRR073308	Third green 3	0.580
	CRR073309	Second white 1	2.263
	CRR073310	Second white 2	8.142
	CRR073311	Second white 3	6.157
	CRR073312	Silver flowering 1	53.584
	CRR073313	Silver flowering 2	46.826
	CRR073314	Silver flowering 3	51.881
	CRR073315	Gold flowering 1	1.042
	CRR073316	Gold flowering 2	0.515
	CRR073317	Gold flowering 3	0.168
	CRR073318	Tawny withering 1	11.642
	CRR073319	Tawny withering 2	16.497
	CRR073320	Tawny withering 3	1.987