Gene detail

Detail information of GWHGAAZE025553

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP10382.1	3.64238E-76	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q39580\|DYL1_CHLRE	8E-18	Dynein 8 kDa light chain, flagellar outer arm
trEMBL	tr\|A0A068UPZ2\|A0A068UPZ2_COFCA	1E-76	Coffea canephora DH200=94 genomic scaffold, scaffold_45 {ECO:0000313\|EMBL:CDP10382.1}
TAIR10	AT5G20110.1	2E-45	Dynein light chain type 1 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	63154461	63158550	+
GWHAAZE00000007	mRNA	63154461	63158550	+
GWHAAZE00000007	exon	63154461	63154886	+
GWHAAZE00000007	exon	63158395	63158550	+
GWHAAZE00000007	CDS	63154461	63154886	+
GWHAAZE00000007	CDS	63158395	63158550	+

Transcript Sequence
>GWHTAAZE025587 ATGGCAACAACTCAAAAGAAAGGAGTCATGCATGTTTACAAGTTGGACACCGGAGCCGGCAGCCTCCCCCCGGGCTCCCCCCAAATTCCGGCCATAACCAAAAAGTCCAATTGGGGAGGCTTGAGAAGGTCGAAAACGTACCGAGAAGTCAAAAATATTAATGATGGGGATATAAAGAGGGAGATCAATGGAGGAGGTCAGATGGTTGAGACGGCGAGAAAATCGTCAGCCTTGATTTTGGAGGGAAGGAAATCGGTGTCGCAGGTGGAGGCGAATGTGGGACCGGTGGCAGCGTTTCTTCAGGTGAAAGTGTTGGTTACCGACATGCCGGGGTTTATGCAAGTCCATGCATTCCGGTGTGCAAGGAGGACTTATGATAACTTGGACAAGTTTAGCTCTAAAACTATGGCCTTCAACATGAAGAAGGAATTTGATAAAGTATATGGGCCGGCCTGGCATTGCATTGTGGGCTCAAGTTTTGGGTCATTTGTGACCCACTCCACTGGTGGTTTTCTCTATTTTACTATGGAGAAATTGTACATTTTGGTCTTCAAGACCAAAGTTCAAAAAACTTTGGATTGA

Network for GWHGAAZE025553

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01221.19	Dynein_light	102	186	1.60E-29

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K10418	DYNLL	Vasopressin-regulated water reabsorption	map04962

Gene Ontology

GO term	Ontology	Name
GO:0007017	biological_process	microtubule-based process
GO:0030286	cellular_component	dynein complex

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	8.394
	SRR3591706	second leaf	5.133
	SRR3591707	mature leaf	10.677
	SRR3591708	Shoot apex	5.092
	SRR3591709	Stem	4.550
	SRR3591710	White floral bud	38.332
	SRR3591711	White flower	13.482
	SRR3591712	Green floral bud	10.560
	SRR3591713	Yellow flower	11.850
SRP173429	SRR8316895	Juvenile bud stage	3.820
	SRR8316896	Juvenile bud stage	3.150
	SRR8316897	Juvenile bud stage	1.270
	SRR8316894	Third green stage	3.044
	SRR8316900	Third green stage	15.426
	SRR8316901	Third green stage	20.021
	SRR8316898	Complete white stage	72.868
	SRR8316899	Complete white stage	82.212
	SRR8316903	Complete white stage	90.015
	SRR8316902	Silver flowering stage	28.653
	SRR8316904	Silver flowering stage	33.746
	SRR8316905	Silver flowering stage	22.293
	SRR8316906	Gold flowering stage	36.550
	SRR8316907	Gold flowering stage	44.653
	SRR8316908	Gold flowering stage	24.572
SRP132670	SRR6706286	Control	42.064
	SRR6706287	Light intensity 50%	51.160
	SRR6706288	Light intensity 20%	49.790
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	7.379
	CNS0095593	Slightly white alabastrum(diploid) 2	17.144
	CNS0095594	Slightly white alabastrum(diploid) 3	7.404
	CNS0095595	Whole white alabastrum(diploid) 2	18.164
	CNS0095596	Whole white alabastrum(diploid) 3	6.799
	CNS0095597	Whole white alabastrum(diploid) 4	19.117
	CNS0095598	Silvery flower (diploied) 1	28.776
	CNS0095599	Silvery flower (diploied) 2	40.993
	CNS0095600	Silvery flower (diploied) 3	56.141
	CNS0095601	Golden flower (diploid) 1	27.083
	CNS0095602	Golden flower (diploid) 2	35.604
	CNS0095603	Golden flower (diploid) 3	38.464
	CNS0095604	Slightly white alabastrum(tetraploid) 1	18.622
	CNS0095605	Slightly white alabastrum(tetraploid) 2	10.022
	CNS0095606	Slightly white alabastrum(tetraploid) 3	47.696
	CNS0095607	Whole white alabastrum(tetraploid) 1	23.453
	CNS0095608	Whole white alabastrum(tetraploid) 2	29.753
	CNS0095609	Whole white alabastrum(tetraploid) 3	15.994
	CNS0095610	Silvery flower (tetraploid) 1	26.130
	CNS0095611	Silvery flower (tetraploid) 2	15.150
	CNS0095612	Silvery flower (tetraploid) 3	3.527
	CNS0095613	Golden flower (tetraploid) 1	41.801
	CNS0095614	Golden flower (tetraploid) 2	22.278
	CNS0095615	Golden flower (tetraploid) 3	11.897
CRA001975	CRR073297	Stem 1	4.689
	CRR073298	Stem 2	6.051
	CRR073299	Stem 3	2.861
	CRR073300	Leaf 1	17.943
	CRR073301	Leaf 2	23.330
	CRR073302	Leaf 3	10.568
	CRR073303	Juvenile bud 1	28.842
	CRR073304	Juvenile bud 2	19.536
	CRR073305	Juvenile bud 3	31.497
	CRR073306	Third green 1	22.233
	CRR073307	Third green 2	35.199
	CRR073308	Third green 3	27.832
	CRR073309	Second white 1	12.409
	CRR073310	Second white 2	9.636
	CRR073311	Second white 3	2.778
	CRR073312	Silver flowering 1	0.663
	CRR073313	Silver flowering 2	0.102
	CRR073314	Silver flowering 3	0.762
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000