Gene detail

Detail information of GWHGAAZE025625

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP03349.1	2.18375E-72	unnamed protein product [Coffea canephora]
COG	YP_007943320.1	0.000001	putative transcription factor, MBF1 like protein
Swissprot	tr\|Q9LV58\|MBF1C_ARATH	8E-69	Multiprotein-bridging factor 1c
trEMBL	tr\|A0A068U595\|A0A068U595_COFCA	8E-73	Coffea canephora DH200=94 genomic scaffold, scaffold_9 {ECO:0000313\|EMBL:CDP03349.1}
TAIR10	AT3G24500.1	1E-54	multiprotein bridging factor 1C

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	64795877	64796320	-
GWHAAZE00000007	mRNA	64795877	64796320	-
GWHAAZE00000007	exon	64795877	64796320	-
GWHAAZE00000007	CDS	64795877	64796320	-

Transcript Sequence
>GWHTAAZE025659 ATGCCGACGCGGTTTGGAGGATCCGTGACGCAAGACTGGGAGCCGGTGGTGATCCGCAAGACCAAACCCAAGGCCCAAGCCCTACGCGACCCGAAAATTGTCAACCAGGCCCTTCGGTCCGGTGGTCAGGTTCAGACGGTGAAGAAATCGGACGCCGGCGTGAACAGGAAGGGACCGGCGACGGCGTTGAACGCTCGGAAGCTGGACGAGGCGGCAGAGCCAGCGGCGCTGGAAAGGGTGGGAACGGAGGTGAGGCAAGCGATACAAAAGGCGAGGATGGAGAAGAGGATGAGCCAAGCAGATTTGGCGAAGCAGATCAATGAGAGGACACAGGTTGTTCAGGAGTATGAGAGTGGGAAAGCAGTTCCCAATCAGGCTGTTTTAGGGAAGATAGAGAGGGTTCTTGGTGTTAAATTGAGGGGGAAGATTAATAATAATAAGTGA

Network for GWHGAAZE025625

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF08523.11	MBF1	11	80	2.50E-18
PF01381.23	HTH_3	88	139	1.20E-11

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MBF1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	11.702
	SRR3591706	second leaf	1.394
	SRR3591707	mature leaf	3.864
	SRR3591708	Shoot apex	6.717
	SRR3591709	Stem	29.634
	SRR3591710	White floral bud	25.573
	SRR3591711	White flower	35.811
	SRR3591712	Green floral bud	24.289
	SRR3591713	Yellow flower	35.374
SRP173429	SRR8316895	Juvenile bud stage	211.282
	SRR8316896	Juvenile bud stage	497.437
	SRR8316897	Juvenile bud stage	216.767
	SRR8316894	Third green stage	38.905
	SRR8316900	Third green stage	86.000
	SRR8316901	Third green stage	221.175
	SRR8316898	Complete white stage	94.553
	SRR8316899	Complete white stage	109.848
	SRR8316903	Complete white stage	150.246
	SRR8316902	Silver flowering stage	289.068
	SRR8316904	Silver flowering stage	255.837
	SRR8316905	Silver flowering stage	269.615
	SRR8316906	Gold flowering stage	792.095
	SRR8316907	Gold flowering stage	784.767
	SRR8316908	Gold flowering stage	431.344
SRP132670	SRR6706286	Control	147.473
	SRR6706287	Light intensity 50%	113.397
	SRR6706288	Light intensity 20%	81.968
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	54.275
	CNS0095593	Slightly white alabastrum(diploid) 2	39.455
	CNS0095594	Slightly white alabastrum(diploid) 3	109.673
	CNS0095595	Whole white alabastrum(diploid) 2	27.417
	CNS0095596	Whole white alabastrum(diploid) 3	17.421
	CNS0095597	Whole white alabastrum(diploid) 4	43.310
	CNS0095598	Silvery flower (diploied) 1	91.612
	CNS0095599	Silvery flower (diploied) 2	531.538
	CNS0095600	Silvery flower (diploied) 3	470.489
	CNS0095601	Golden flower (diploid) 1	675.154
	CNS0095602	Golden flower (diploid) 2	349.038
	CNS0095603	Golden flower (diploid) 3	367.649
	CNS0095604	Slightly white alabastrum(tetraploid) 1	114.757
	CNS0095605	Slightly white alabastrum(tetraploid) 2	129.124
	CNS0095606	Slightly white alabastrum(tetraploid) 3	97.044
	CNS0095607	Whole white alabastrum(tetraploid) 1	85.838
	CNS0095608	Whole white alabastrum(tetraploid) 2	102.414
	CNS0095609	Whole white alabastrum(tetraploid) 3	146.500
	CNS0095610	Silvery flower (tetraploid) 1	301.039
	CNS0095611	Silvery flower (tetraploid) 2	381.179
	CNS0095612	Silvery flower (tetraploid) 3	180.772
	CNS0095613	Golden flower (tetraploid) 1	736.079
	CNS0095614	Golden flower (tetraploid) 2	404.582
	CNS0095615	Golden flower (tetraploid) 3	211.206
CRA001975	CRR073297	Stem 1	28.725
	CRR073298	Stem 2	38.669
	CRR073299	Stem 3	39.294
	CRR073300	Leaf 1	20.779
	CRR073301	Leaf 2	16.859
	CRR073302	Leaf 3	16.373
	CRR073303	Juvenile bud 1	18.784
	CRR073304	Juvenile bud 2	33.101
	CRR073305	Juvenile bud 3	22.471
	CRR073306	Third green 1	186.631
	CRR073307	Third green 2	156.528
	CRR073308	Third green 3	124.486
	CRR073309	Second white 1	78.722
	CRR073310	Second white 2	111.936
	CRR073311	Second white 3	86.693
	CRR073312	Silver flowering 1	39.810
	CRR073313	Silver flowering 2	27.871
	CRR073314	Silver flowering 3	35.669
	CRR073315	Gold flowering 1	2.158
	CRR073316	Gold flowering 2	2.917
	CRR073317	Gold flowering 3	2.205
	CRR073318	Tawny withering 1	7.308
	CRR073319	Tawny withering 2	21.388
	CRR073320	Tawny withering 3	12.444