Gene detail

Detail information of GWHGAAZE025640

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006590898.1	1.13675E-26	PREDICTED: ras-related protein Rab7 isoform X2 [Glycine max]
Swissprot	tr\|Q9C820\|RAG3D_ARATH	3E-24	Ras-related protein RABG3d
trEMBL	tr\|I1LJE6\|I1LJE6_SOYBN	4E-27	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA11G12630.4}
TAIR10	AT1G52280.1	7E-20	RAB GTPase homolog G3D

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	65198901	65199672	+
GWHAAZE00000007	mRNA	65198901	65199672	+
GWHAAZE00000007	exon	65198901	65199035	+
GWHAAZE00000007	exon	65199604	65199672	+
GWHAAZE00000007	CDS	65198901	65199035	+
GWHAAZE00000007	CDS	65199604	65199672	+

Transcript Sequence
>GWHTAAZE025674 TATATATGGGATACAGCCGGGCACGAAAGATTTCAGAGCCTTGGTGTGGCTTTCTACCGAGGTGGAGATTGTTGTGTTCTAGTTTATGATGTGAACGAACATGAAGCTAGTCATTCGAAAACCTCAACAATTGGCGTGTCCGAAAAGAAGGCGAGAGCTTGGTGCACTTCCAAAGGAAATATTTCTTACTTTGAAACTTCATAG

Network for GWHGAAZE025640

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00071.23	Ras	2	36	1.90E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07897	RAB7A	Endocytosis	map04144
		Phagosome	map04145
		Autophagy - animal	map04140
		Autophagy - yeast	map04138
		Mitophagy - animal	map04137

Gene Ontology

GO term	Ontology	Name
GO:0003924	molecular_function	GTPase activity
GO:0005525	molecular_function	GTP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.431
	SRR3591712	Green floral bud	0.986
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.507
	SRR8316899	Complete white stage	0.193
	SRR8316903	Complete white stage	1.051
	SRR8316902	Silver flowering stage	0.239
	SRR8316904	Silver flowering stage	0.116
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.156
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.073
	SRR6706287	Light intensity 50%	0.406
	SRR6706288	Light intensity 20%	0.667
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.355
	CNS0095593	Slightly white alabastrum(diploid) 2	0.184
	CNS0095594	Slightly white alabastrum(diploid) 3	0.191
	CNS0095595	Whole white alabastrum(diploid) 2	0.532
	CNS0095596	Whole white alabastrum(diploid) 3	0.788
	CNS0095597	Whole white alabastrum(diploid) 4	1.354
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.003
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.061
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.475
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.308
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.524
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.442
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.942
	CNS0095610	Silvery flower (tetraploid) 1	0.731
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.289
	CNS0095613	Golden flower (tetraploid) 1	0.161
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.069
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.014
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.010
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.011
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000