Gene detail

Detail information of GWHGAAZE025645

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009793479.1	4.4808E-43	PREDICTED: chloroplast processing peptidase-like isoform X3 [Nicotiana sylvestris]
COG	YP_003888231.1	7E-12	signal peptidase I
Swissprot	tr\|Q8H0W1\|PLSP1_ARATH	8E-31	Chloroplast processing peptidase (Precursor)
trEMBL	tr\|A0A067E4S5\|A0A067E4S5_CITSI	1E-39	Uncharacterized protein {ECO:0000313\|EMBL:KDO48885.1}
TAIR10	AT3G24590.1	7E-26	plastidic type i signal peptidase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	65248932	65249489	+
GWHAAZE00000007	mRNA	65248932	65249489	+
GWHAAZE00000007	exon	65248932	65249489	+
GWHAAZE00000007	CDS	65248932	65249489	+

Transcript Sequence
>GWHTAAZE025679 ATGATATCTCTACAACTTTTCCCCGGATTCTCTCCCCTCCAAAACCCTAATTTCACTTTCCCCCAATGCTTCTCCACCAAAGCAACCCTCATCAATTTCAGCCCTTTATTAAAATCCCTCAAATTCAATCACCCCCACATAAACCCTCTTCACAAAACCCCAAATCTTGCGCAATTCAACCACCCACTCACCAAAACCCACACCCAAAGACTAAATTGCAAGAAATTCCAAGGTTCAGGCGAGGAAACTAAGGCGGTTTTGGACTTGGATGACAGCGGCGGCGGGGGTGGCGGCGGAGATGGCGGCGGAGGGGATGAAGAGAAGAAGAATGGATTCTTGCCGGAATGGTTGGATTTTACCTCGGATGATGCTAAAACTGTTTTTGCAGCATTTGTTGTATCGATTGCTTTTAGATCTTTTATAGCTGAGCCCAGATACATTCCTTCATTGTCTATGTATCCTACATTTGATGTTGGAGATCGTCTCGTTGCCGAAAAGGTTTGTTAGTTTGATTTTGATTTTTGTTTTATTATTTATTGCTTGAAGCTTGAAGCTTGA

Network for GWHGAAZE025645

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF10502.10	Peptidase_S26	124	167	1.30E-06

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03100	lepB	Protein export	map03060

Gene Ontology

GO term	Ontology	Name
GO:0016021	cellular_component	integral component of membrane
GO:0008236	molecular_function	serine-type peptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	27.860
	SRR3591706	second leaf	33.461
	SRR3591707	mature leaf	26.080
	SRR3591708	Shoot apex	41.149
	SRR3591709	Stem	14.576
	SRR3591710	White floral bud	35.215
	SRR3591711	White flower	43.948
	SRR3591712	Green floral bud	46.155
	SRR3591713	Yellow flower	54.515
SRP173429	SRR8316895	Juvenile bud stage	17.766
	SRR8316896	Juvenile bud stage	22.855
	SRR8316897	Juvenile bud stage	10.891
	SRR8316894	Third green stage	10.119
	SRR8316900	Third green stage	50.151
	SRR8316901	Third green stage	38.858
	SRR8316898	Complete white stage	17.864
	SRR8316899	Complete white stage	42.361
	SRR8316903	Complete white stage	21.676
	SRR8316902	Silver flowering stage	15.233
	SRR8316904	Silver flowering stage	20.356
	SRR8316905	Silver flowering stage	14.791
	SRR8316906	Gold flowering stage	50.569
	SRR8316907	Gold flowering stage	40.722
	SRR8316908	Gold flowering stage	41.807
SRP132670	SRR6706286	Control	35.671
	SRR6706287	Light intensity 50%	38.657
	SRR6706288	Light intensity 20%	42.208
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	11.235
	CNS0095593	Slightly white alabastrum(diploid) 2	9.111
	CNS0095594	Slightly white alabastrum(diploid) 3	6.530
	CNS0095595	Whole white alabastrum(diploid) 2	13.766
	CNS0095596	Whole white alabastrum(diploid) 3	9.506
	CNS0095597	Whole white alabastrum(diploid) 4	12.184
	CNS0095598	Silvery flower (diploied) 1	22.693
	CNS0095599	Silvery flower (diploied) 2	13.250
	CNS0095600	Silvery flower (diploied) 3	32.661
	CNS0095601	Golden flower (diploid) 1	14.919
	CNS0095602	Golden flower (diploid) 2	28.400
	CNS0095603	Golden flower (diploid) 3	27.707
	CNS0095604	Slightly white alabastrum(tetraploid) 1	14.313
	CNS0095605	Slightly white alabastrum(tetraploid) 2	10.247
	CNS0095606	Slightly white alabastrum(tetraploid) 3	31.206
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.703
	CNS0095608	Whole white alabastrum(tetraploid) 2	8.327
	CNS0095609	Whole white alabastrum(tetraploid) 3	36.089
	CNS0095610	Silvery flower (tetraploid) 1	36.073
	CNS0095611	Silvery flower (tetraploid) 2	36.741
	CNS0095612	Silvery flower (tetraploid) 3	32.419
	CNS0095613	Golden flower (tetraploid) 1	23.121
	CNS0095614	Golden flower (tetraploid) 2	30.047
	CNS0095615	Golden flower (tetraploid) 3	37.245
CRA001975	CRR073297	Stem 1	22.060
	CRR073298	Stem 2	23.416
	CRR073299	Stem 3	20.604
	CRR073300	Leaf 1	27.533
	CRR073301	Leaf 2	25.459
	CRR073302	Leaf 3	23.766
	CRR073303	Juvenile bud 1	24.591
	CRR073304	Juvenile bud 2	30.349
	CRR073305	Juvenile bud 3	24.314
	CRR073306	Third green 1	15.588
	CRR073307	Third green 2	8.484
	CRR073308	Third green 3	14.104
	CRR073309	Second white 1	20.050
	CRR073310	Second white 2	13.817
	CRR073311	Second white 3	13.193
	CRR073312	Silver flowering 1	16.034
	CRR073313	Silver flowering 2	10.757
	CRR073314	Silver flowering 3	15.206
	CRR073315	Gold flowering 1	21.961
	CRR073316	Gold flowering 2	31.151
	CRR073317	Gold flowering 3	29.294
	CRR073318	Tawny withering 1	6.129
	CRR073319	Tawny withering 2	6.310
	CRR073320	Tawny withering 3	4.221