Gene detail

Detail information of GWHGAAZE025749

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006451407.1	6.47017E-75	hypothetical protein CICLE_v10009919mg [Citrus clementina]
trEMBL	tr\|A0A067EVX0\|A0A067EVX0_CITSI	2E-75	Uncharacterized protein {ECO:0000313\|EMBL:KDO59269.1}
TAIR10	AT2G19680.2	1E-54	Mitochondrial ATP synthase subunit G protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	67187351	67190273	-
GWHAAZE00000007	mRNA	67187351	67190273	-
GWHAAZE00000007	exon	67187351	67187537	-
GWHAAZE00000007	exon	67190092	67190273	-
GWHAAZE00000007	CDS	67190092	67190273	-
GWHAAZE00000007	CDS	67187351	67187537	-

Transcript Sequence
>GWHTAAZE025783 ATGGCGTCAAAGTTGCACCAATTGAAATCTACGGCATGTCAAGCTAAACAGTTTGTGTCCAAGCATGGCACCACTTACTACAAGCAGTTGTTGGAGCAAAACAAGCAGTACATCCAGGAGCCTCCTACTGTCGAGAAATGCGACCTTTTGTCCAAGCAGTTGTTCTACACTCGTCTTGCTAGTATTCCTAGTCGCTATGAATCATTGTTGAAGGAAGTGGATTACATAAAGCACATATGGAAGAACAGGCAGGAGCTTAAGGTGGAGGATGCTGGCATTGCCGCTCTGTTCGGGCTTGAGTGCTTTGCGTGGTTTTGTGCCGGCGAGATAGTCGGAAGGGGATTCACATTCACCGGCTACTACGTCTGA

Network for GWHGAAZE025749

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04718.16	ATP-synt_G	17	120	1.10E-23

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02140	ATPeFG, ATP5L, ATP20	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0015986	biological_process	ATP synthesis coupled proton transport
GO:0000276	cellular_component	mitochondrial proton-transporting ATP synthase complex, coupling factor F(o)
GO:0015078	molecular_function	proton transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	267.831
	SRR3591706	second leaf	134.475
	SRR3591707	mature leaf	86.460
	SRR3591708	Shoot apex	212.802
	SRR3591709	Stem	194.107
	SRR3591710	White floral bud	191.139
	SRR3591711	White flower	228.658
	SRR3591712	Green floral bud	253.223
	SRR3591713	Yellow flower	245.987
SRP173429	SRR8316895	Juvenile bud stage	105.116
	SRR8316896	Juvenile bud stage	143.867
	SRR8316897	Juvenile bud stage	82.141
	SRR8316894	Third green stage	69.881
	SRR8316900	Third green stage	285.130
	SRR8316901	Third green stage	272.943
	SRR8316898	Complete white stage	109.619
	SRR8316899	Complete white stage	240.499
	SRR8316903	Complete white stage	138.360
	SRR8316902	Silver flowering stage	112.722
	SRR8316904	Silver flowering stage	116.891
	SRR8316905	Silver flowering stage	64.189
	SRR8316906	Gold flowering stage	219.972
	SRR8316907	Gold flowering stage	228.918
	SRR8316908	Gold flowering stage	242.458
SRP132670	SRR6706286	Control	197.990
	SRR6706287	Light intensity 50%	206.678
	SRR6706288	Light intensity 20%	236.284
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	185.086
	CNS0095593	Slightly white alabastrum(diploid) 2	221.976
	CNS0095594	Slightly white alabastrum(diploid) 3	186.305
	CNS0095595	Whole white alabastrum(diploid) 2	218.484
	CNS0095596	Whole white alabastrum(diploid) 3	253.355
	CNS0095597	Whole white alabastrum(diploid) 4	194.186
	CNS0095598	Silvery flower (diploied) 1	139.729
	CNS0095599	Silvery flower (diploied) 2	180.032
	CNS0095600	Silvery flower (diploied) 3	177.819
	CNS0095601	Golden flower (diploid) 1	143.105
	CNS0095602	Golden flower (diploid) 2	152.604
	CNS0095603	Golden flower (diploid) 3	156.117
	CNS0095604	Slightly white alabastrum(tetraploid) 1	215.107
	CNS0095605	Slightly white alabastrum(tetraploid) 2	192.906
	CNS0095606	Slightly white alabastrum(tetraploid) 3	193.173
	CNS0095607	Whole white alabastrum(tetraploid) 1	178.878
	CNS0095608	Whole white alabastrum(tetraploid) 2	190.892
	CNS0095609	Whole white alabastrum(tetraploid) 3	199.896
	CNS0095610	Silvery flower (tetraploid) 1	190.212
	CNS0095611	Silvery flower (tetraploid) 2	168.224
	CNS0095612	Silvery flower (tetraploid) 3	155.895
	CNS0095613	Golden flower (tetraploid) 1	163.839
	CNS0095614	Golden flower (tetraploid) 2	183.071
	CNS0095615	Golden flower (tetraploid) 3	126.397
CRA001975	CRR073297	Stem 1	125.465
	CRR073298	Stem 2	129.871
	CRR073299	Stem 3	123.840
	CRR073300	Leaf 1	149.696
	CRR073301	Leaf 2	166.438
	CRR073302	Leaf 3	195.244
	CRR073303	Juvenile bud 1	171.831
	CRR073304	Juvenile bud 2	192.978
	CRR073305	Juvenile bud 3	130.571
	CRR073306	Third green 1	82.261
	CRR073307	Third green 2	94.954
	CRR073308	Third green 3	83.338
	CRR073309	Second white 1	95.222
	CRR073310	Second white 2	60.831
	CRR073311	Second white 3	46.465
	CRR073312	Silver flowering 1	51.747
	CRR073313	Silver flowering 2	66.628
	CRR073314	Silver flowering 3	41.654
	CRR073315	Gold flowering 1	58.394
	CRR073316	Gold flowering 2	62.986
	CRR073317	Gold flowering 3	51.102
	CRR073318	Tawny withering 1	94.927
	CRR073319	Tawny withering 2	98.327
	CRR073320	Tawny withering 3	96.001