Gene detail

Detail information of GWHGAAZE025827

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011094009.1	7.6043E-24	PREDICTED: DNA-directed RNA polymerase III subunit RPC4 [Sesamum indicum]
trEMBL	tr\|M1AR07\|M1AR07_SOLTU	8E-18	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400028366}
TAIR10	AT5G09380.1	0.000003	RNA polymerase III RPC4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	68523813	68525036	-
GWHAAZE00000007	mRNA	68523813	68525036	-
GWHAAZE00000007	exon	68523813	68523907	-
GWHAAZE00000007	exon	68524370	68524409	-
GWHAAZE00000007	exon	68524530	68524587	-
GWHAAZE00000007	exon	68524681	68524739	-
GWHAAZE00000007	exon	68524836	68524904	-
GWHAAZE00000007	exon	68525034	68525036	-
GWHAAZE00000007	CDS	68525034	68525036	-
GWHAAZE00000007	CDS	68524836	68524904	-
GWHAAZE00000007	CDS	68524681	68524739	-
GWHAAZE00000007	CDS	68524530	68524587	-
GWHAAZE00000007	CDS	68524370	68524409	-
GWHAAZE00000007	CDS	68523813	68523907	-

Transcript Sequence
>GWHTAAZE025861 ATGAGGTTTTGTCATCCCACAGCAATGAATCAAGATTGTCTAGGGAGTGCTCCCTCTAAACCCCCTAGAAAGGTGAGATTTGCTCCAAAAGCTCCTCCTCGCAGGGACCAAAAGCCCATTTTGCCTAAAGCTGAAAAGGTTGAAGATACTGACACGGCCCAGGAGGAACTGATGCGATGGCTATACAATGAAACTTCTATGAAGGGGAAGTCTAAATTTGAAAAGAAATCGGTGCATACACAAGTTACATTTGGTTTTGGAGGTGCATCCTCCATGAGATCATATGGTCCTACCAAGGGTGGCATTAACAGGTCTCAAGGTTGA

Network for GWHGAAZE025827

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03026	RPC4, POLR3D	RNA polymerase	map03020
K03026	RPC4, POLR3D	Cytosolic DNA-sensing pathway	map04623

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.167
	SRR3591706	second leaf	0.302
	SRR3591707	mature leaf	0.328
	SRR3591708	Shoot apex	2.274
	SRR3591709	Stem	3.237
	SRR3591710	White floral bud	1.162
	SRR3591711	White flower	1.634
	SRR3591712	Green floral bud	1.872
	SRR3591713	Yellow flower	0.763
SRP173429	SRR8316895	Juvenile bud stage	0.710
	SRR8316896	Juvenile bud stage	1.041
	SRR8316897	Juvenile bud stage	0.584
	SRR8316894	Third green stage	0.187
	SRR8316900	Third green stage	0.806
	SRR8316901	Third green stage	0.239
	SRR8316898	Complete white stage	0.310
	SRR8316899	Complete white stage	0.800
	SRR8316903	Complete white stage	0.453
	SRR8316902	Silver flowering stage	0.086
	SRR8316904	Silver flowering stage	0.268
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.125
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.304
SRP132670	SRR6706286	Control	0.749
	SRR6706287	Light intensity 50%	0.532
	SRR6706288	Light intensity 20%	0.451
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.853
	CNS0095593	Slightly white alabastrum(diploid) 2	2.018
	CNS0095594	Slightly white alabastrum(diploid) 3	0.776
	CNS0095595	Whole white alabastrum(diploid) 2	0.782
	CNS0095596	Whole white alabastrum(diploid) 3	0.397
	CNS0095597	Whole white alabastrum(diploid) 4	0.163
	CNS0095598	Silvery flower (diploied) 1	0.122
	CNS0095599	Silvery flower (diploied) 2	0.087
	CNS0095600	Silvery flower (diploied) 3	0.159
	CNS0095601	Golden flower (diploid) 1	0.142
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.062
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.997
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.399
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.091
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.508
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.236
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.277
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.080
	CNS0095613	Golden flower (tetraploid) 1	0.226
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.353
	CRR073299	Stem 3	0.123
	CRR073300	Leaf 1	0.341
	CRR073301	Leaf 2	0.938
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000