Gene detail

Detail information of GWHGAAZE025907

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010249552.1	3.0544E-121	PREDICTED: GATA transcription factor 12 [Nelumbo nucifera]
Swissprot	tr\|P69781\|GAT12_ARATH	3E-84	GATA transcription factor 12
trEMBL	tr\|M5Y804\|M5Y804_PRUPE	1E-109	Uncharacterized protein {ECO:0000313\|EMBL:EMJ28130.1}
TAIR10	AT4G32890.1	3E-62	GATA transcription factor 9

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	70019966	70020691	+
GWHAAZE00000007	mRNA	70019966	70020691	+
GWHAAZE00000007	exon	70019966	70020237	+
GWHAAZE00000007	exon	70020283	70020691	+
GWHAAZE00000007	CDS	70019966	70020237	+
GWHAAZE00000007	CDS	70020283	70020691	+

Transcript Sequence
>GWHTAAZE025941 ATGGCTGAGCTGGAGTGGCTATCCAATTTTGTGGAAGAATCATTCTCCAGTGAAGATTTGCAGAAACTGCACTTGATTTCGGGAATGAAAGTGCGCAACGGCAGCAATACATCGGAAAACCACCAATTCCAGCTGGAAAACAATCGAAACAACCACATTTTCAATCCAGAGATGACAGTCCCCGGCAAGGCACGTAGCAAGCGCTCACGTGCCGCCCCATGCAATTGGACCTCCCGTCTTCTTGTACTTTCTCCATCAACCACTACTACAATGACGGTTAAGACCACCCCGAAGAAAAAAGAATCGAGTGACAACAACATGGGCCCTGCCGCAAATAGTGGGGGTGATGGGAGGAGGTGCCTCCACTGCGCCACTGATAAGACACCTCAGTGGCGAACTGGACCTATGGGCCCAAAAACACTTTGCAATGCTTGTGGGGTACGCTACAAGTCAGGCCGGCTCGTGCCAGAGTATCGGCCCGCAGCAAGCCCCACATTTGTGCTGACAAAGCATTCCAATTCGCACCGCAAGGTGCTTGAGCTTAGGAGGCAGAAGGAGATGCAGAGGGTTCAACAACAGCAACAACAATTTCTTCATCAAAACATGATGTTTGACGTATCTAACGGTGACGATTACTTGATCCACCAACATATTGGGCCAGATTATCGGCAGCTGATCTAG

Network for GWHGAAZE025907

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00320.28	GATA	120	153	1.70E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2C2-GATA

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0045893	biological_process	positive regulation of transcription, DNA-templated
GO:0005634	cellular_component	nucleus
GO:0008270	molecular_function	zinc ion binding
GO:0043565	molecular_function	sequence-specific DNA binding
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.647
	SRR3591706	second leaf	3.112
	SRR3591707	mature leaf	0.603
	SRR3591708	Shoot apex	1.471
	SRR3591709	Stem	0.662
	SRR3591710	White floral bud	1.701
	SRR3591711	White flower	0.160
	SRR3591712	Green floral bud	18.435
	SRR3591713	Yellow flower	0.202
SRP173429	SRR8316895	Juvenile bud stage	3.428
	SRR8316896	Juvenile bud stage	21.774
	SRR8316897	Juvenile bud stage	12.501
	SRR8316894	Third green stage	6.220
	SRR8316900	Third green stage	25.939
	SRR8316901	Third green stage	26.441
	SRR8316898	Complete white stage	2.405
	SRR8316899	Complete white stage	16.571
	SRR8316903	Complete white stage	4.756
	SRR8316902	Silver flowering stage	0.648
	SRR8316904	Silver flowering stage	1.182
	SRR8316905	Silver flowering stage	0.686
	SRR8316906	Gold flowering stage	1.810
	SRR8316907	Gold flowering stage	1.043
	SRR8316908	Gold flowering stage	0.663
SRP132670	SRR6706286	Control	25.068
	SRR6706287	Light intensity 50%	25.366
	SRR6706288	Light intensity 20%	24.536
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	26.108
	CNS0095593	Slightly white alabastrum(diploid) 2	20.427
	CNS0095594	Slightly white alabastrum(diploid) 3	29.416
	CNS0095595	Whole white alabastrum(diploid) 2	37.865
	CNS0095596	Whole white alabastrum(diploid) 3	45.505
	CNS0095597	Whole white alabastrum(diploid) 4	36.795
	CNS0095598	Silvery flower (diploied) 1	0.655
	CNS0095599	Silvery flower (diploied) 2	0.385
	CNS0095600	Silvery flower (diploied) 3	1.083
	CNS0095601	Golden flower (diploid) 1	0.071
	CNS0095602	Golden flower (diploid) 2	0.548
	CNS0095603	Golden flower (diploid) 3	0.313
	CNS0095604	Slightly white alabastrum(tetraploid) 1	37.599
	CNS0095605	Slightly white alabastrum(tetraploid) 2	40.665
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.022
	CNS0095607	Whole white alabastrum(tetraploid) 1	45.548
	CNS0095608	Whole white alabastrum(tetraploid) 2	38.945
	CNS0095609	Whole white alabastrum(tetraploid) 3	28.830
	CNS0095610	Silvery flower (tetraploid) 1	0.172
	CNS0095611	Silvery flower (tetraploid) 2	0.040
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.181
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.752
CRA001975	CRR073297	Stem 1	8.751
	CRR073298	Stem 2	12.018
	CRR073299	Stem 3	11.598
	CRR073300	Leaf 1	28.858
	CRR073301	Leaf 2	24.755
	CRR073302	Leaf 3	22.686
	CRR073303	Juvenile bud 1	36.844
	CRR073304	Juvenile bud 2	32.804
	CRR073305	Juvenile bud 3	20.788
	CRR073306	Third green 1	0.133
	CRR073307	Third green 2	0.232
	CRR073308	Third green 3	0.738
	CRR073309	Second white 1	0.032
	CRR073310	Second white 2	0.099
	CRR073311	Second white 3	0.157
	CRR073312	Silver flowering 1	0.097
	CRR073313	Silver flowering 2	0.232
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.179
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.110
	CRR073318	Tawny withering 1	0.938
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	2.266