Gene detail

Detail information of GWHGAAZE026017

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AFK44279.1	8.54543E-50	unknown [Lotus japonicus]
Swissprot	tr\|Q9SSB8\|CX5B2_ARATH	8E-47	Cytochrome c oxidase subunit 5b-2, mitochondrial (Precursor)
trEMBL	tr\|I3SVI7\|I3SVI7_LOTJA	3E-50	Uncharacterized protein {ECO:0000313\|EMBL:AFK44279.1}
TAIR10	AT1G80230.1	4E-32	Rubredoxin-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	71883778	71886589	+
GWHAAZE00000007	mRNA	71883778	71886589	+
GWHAAZE00000007	exon	71883778	71883861	+
GWHAAZE00000007	exon	71884020	71884070	+
GWHAAZE00000007	exon	71886302	71886368	+
GWHAAZE00000007	exon	71886471	71886589	+
GWHAAZE00000007	CDS	71883778	71883861	+
GWHAAZE00000007	CDS	71884020	71884070	+
GWHAAZE00000007	CDS	71886302	71886368	+
GWHAAZE00000007	CDS	71886471	71886589	+

Transcript Sequence
>GWHTAAZE026051 CTAACAAAGGGAAAGAAGAGAGTTGAAGATATAATGCCTATTGCTACCGGACATGAACGTGAAGAACTTGAGGCTGAGCTTGAGGGAAGGAACATTTTGGAGATGAATTTTCCAGTTGGACCATTTGGAACCAAGGAAGCACCTGCTATTGTTCAGTCAGTTTATGACAAAAGAATAGTTGGATGCCCCGGTGGTGAGGGAGAAGATGAGCACGACATCGTGTGGTTTTGGCTAGAGAAAGGCAAACCTCATGAGTGCCCGTCTGTTCTCAATATTTCAAGGCAATTGAGATTTTCCTCACAAATTAGTAGTAGTAAATAA

Network for GWHGAAZE026017

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01215.20	COX5B	15	88	1.00E-15

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02265	COX5B	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Cardiac muscle contraction	map04260
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0005740	cellular_component	mitochondrial envelope
GO:0004129	molecular_function	cytochrome-c oxidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	1.588
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	1.518
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.172
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.920
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	1.566
	SRR8316896	Juvenile bud stage	2.020
	SRR8316897	Juvenile bud stage	0.467
	SRR8316894	Third green stage	0.437
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.943
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.098
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.201
	SRR6706287	Light intensity 50%	0.098
	SRR6706288	Light intensity 20%	0.143
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.996
	CNS0095593	Slightly white alabastrum(diploid) 2	0.653
	CNS0095594	Slightly white alabastrum(diploid) 3	1.459
	CNS0095595	Whole white alabastrum(diploid) 2	1.178
	CNS0095596	Whole white alabastrum(diploid) 3	1.722
	CNS0095597	Whole white alabastrum(diploid) 4	1.118
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.095
	CNS0095600	Silvery flower (diploied) 3	0.119
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.509
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.099
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.358
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.431
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.045
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.915
	CRR073298	Stem 2	0.851
	CRR073299	Stem 3	1.456
	CRR073300	Leaf 1	0.615
	CRR073301	Leaf 2	0.495
	CRR073302	Leaf 3	0.310
	CRR073303	Juvenile bud 1	0.270
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	2.509
	CRR073316	Gold flowering 2	1.400
	CRR073317	Gold flowering 3	1.618
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000