Gene detail

Detail information of GWHGAAZE026103

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011081975.1	1.24964E-94	PREDICTED: nuclear nucleic acid-binding protein C1D [Sesamum indicum]
trEMBL	tr\|W9REK4\|W9REK4_9ROSA	2E-94	Uncharacterized protein {ECO:0000313\|EMBL:EXB86665.1}
TAIR10	AT5G25080.1	4E-60	Sas10/Utp3/C1D family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	73518526	73520638	+
GWHAAZE00000007	mRNA	73518526	73520638	+
GWHAAZE00000007	exon	73518526	73518715	+
GWHAAZE00000007	exon	73518809	73518864	+
GWHAAZE00000007	exon	73519245	73519299	+
GWHAAZE00000007	exon	73520234	73520314	+
GWHAAZE00000007	exon	73520403	73520638	+
GWHAAZE00000007	CDS	73518526	73518715	+
GWHAAZE00000007	CDS	73518809	73518864	+
GWHAAZE00000007	CDS	73519245	73519299	+
GWHAAZE00000007	CDS	73520234	73520314	+
GWHAAZE00000007	CDS	73520403	73520638	+

Transcript Sequence
>GWHTAAZE026137 ATGGAAGGAGCAGTACCAGAATCAGTAATGGAGGTGGTGAATACAACATCCAAAAACATGCAAGAATTCAAATCTCAGTTTCTCGATTTCTTATCTCAATGCGATAGCGAAGTTTTAGCTGAAATGGAGCCCCTTCAACGGGCAAAATCTCTCCTTTTGATTGCAAAAGCTACTACCACTCTCTTTACTTTGAGGTTGCGGTGCAAAGGTGTTAATCCACATGACCATTCTGTCAAATCAGAGCTTGATAGACTAAGCCTGTATGAAGACAAACTGGAGCGCTTAGTAGATTTGAGTAACGCGCCGCTGCGACCTTCAGCTACCATAAATTCCCAAGCAGCAACCCGTTTTATTGAGCATTCATTGCCTGATCTTACACCAGAGCAGAGGCAAAGCATGAGGGAACTCAGTAAAGGGGAAGGCACAAGGATCAAGTATTTAGAGAGAAATGTCCATAAGAAGAGGAAATGTCAATCTGGGCAGAAACAGTCCGTCCAAACTGCCGCTCAAGAATTTCTTGAGAAAGCAACCCGTGAACTTCTTGGTGATAATAAAGATGGCTTTAAGGGGCCTTTAAAACCTCAGGATTCTGATGATGATGACCTGTTAATGGATTGA

Network for GWHGAAZE026103

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04000.16	Sas10_Utp3	14	90	4.80E-07

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12592	C1D, LRP1	RNA degradation	map03018

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	19.915
	SRR3591706	second leaf	14.875
	SRR3591707	mature leaf	14.346
	SRR3591708	Shoot apex	32.196
	SRR3591709	Stem	17.358
	SRR3591710	White floral bud	19.538
	SRR3591711	White flower	23.407
	SRR3591712	Green floral bud	24.490
	SRR3591713	Yellow flower	16.401
SRP173429	SRR8316895	Juvenile bud stage	16.948
	SRR8316896	Juvenile bud stage	19.175
	SRR8316897	Juvenile bud stage	10.984
	SRR8316894	Third green stage	8.425
	SRR8316900	Third green stage	24.338
	SRR8316901	Third green stage	23.219
	SRR8316898	Complete white stage	6.450
	SRR8316899	Complete white stage	29.285
	SRR8316903	Complete white stage	13.356
	SRR8316902	Silver flowering stage	5.182
	SRR8316904	Silver flowering stage	7.912
	SRR8316905	Silver flowering stage	3.156
	SRR8316906	Gold flowering stage	14.104
	SRR8316907	Gold flowering stage	11.230
	SRR8316908	Gold flowering stage	13.148
SRP132670	SRR6706286	Control	21.006
	SRR6706287	Light intensity 50%	21.057
	SRR6706288	Light intensity 20%	21.830
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	17.957
	CNS0095593	Slightly white alabastrum(diploid) 2	23.683
	CNS0095594	Slightly white alabastrum(diploid) 3	18.270
	CNS0095595	Whole white alabastrum(diploid) 2	12.521
	CNS0095596	Whole white alabastrum(diploid) 3	14.519
	CNS0095597	Whole white alabastrum(diploid) 4	13.073
	CNS0095598	Silvery flower (diploied) 1	16.568
	CNS0095599	Silvery flower (diploied) 2	14.678
	CNS0095600	Silvery flower (diploied) 3	12.874
	CNS0095601	Golden flower (diploid) 1	11.669
	CNS0095602	Golden flower (diploid) 2	12.876
	CNS0095603	Golden flower (diploid) 3	14.256
	CNS0095604	Slightly white alabastrum(tetraploid) 1	21.169
	CNS0095605	Slightly white alabastrum(tetraploid) 2	16.362
	CNS0095606	Slightly white alabastrum(tetraploid) 3	28.338
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.444
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.340
	CNS0095609	Whole white alabastrum(tetraploid) 3	17.485
	CNS0095610	Silvery flower (tetraploid) 1	13.528
	CNS0095611	Silvery flower (tetraploid) 2	16.326
	CNS0095612	Silvery flower (tetraploid) 3	13.318
	CNS0095613	Golden flower (tetraploid) 1	9.096
	CNS0095614	Golden flower (tetraploid) 2	11.642
	CNS0095615	Golden flower (tetraploid) 3	5.791
CRA001975	CRR073297	Stem 1	29.686
	CRR073298	Stem 2	20.877
	CRR073299	Stem 3	18.950
	CRR073300	Leaf 1	23.933
	CRR073301	Leaf 2	23.490
	CRR073302	Leaf 3	19.148
	CRR073303	Juvenile bud 1	19.347
	CRR073304	Juvenile bud 2	14.218
	CRR073305	Juvenile bud 3	18.727
	CRR073306	Third green 1	4.987
	CRR073307	Third green 2	4.309
	CRR073308	Third green 3	5.622
	CRR073309	Second white 1	6.717
	CRR073310	Second white 2	4.448
	CRR073311	Second white 3	5.737
	CRR073312	Silver flowering 1	3.500
	CRR073313	Silver flowering 2	1.998
	CRR073314	Silver flowering 3	2.612
	CRR073315	Gold flowering 1	13.640
	CRR073316	Gold flowering 2	15.647
	CRR073317	Gold flowering 3	11.132
	CRR073318	Tawny withering 1	19.989
	CRR073319	Tawny withering 2	17.192
	CRR073320	Tawny withering 3	25.599