Gene detail

Detail information of GWHGAAZE026108

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007223774.1	7.2929E-103	hypothetical protein PRUPE_ppa010584mg [Prunus persica]
COG	YP_433552.1	3E-56	glutathione peroxidase
Swissprot	tr\|Q9SZ54\|GPX7_ARATH	2E-98	Putative glutathione peroxidase 7, chloroplastic (Precursor)
trEMBL	tr\|M5XTR8\|M5XTR8_PRUPE	3E-103	Glutathione peroxidase {ECO:0000256\|RuleBase:RU000499}
TAIR10	AT4G31870.1	2E-78	glutathione peroxidase 7

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	73616564	73619236	+
GWHAAZE00000007	mRNA	73616564	73619236	+
GWHAAZE00000007	exon	73616564	73616578	+
GWHAAZE00000007	exon	73616780	73616856	+
GWHAAZE00000007	exon	73617049	73617110	+
GWHAAZE00000007	exon	73618063	73618181	+
GWHAAZE00000007	exon	73618262	73618429	+
GWHAAZE00000007	exon	73619207	73619236	+
GWHAAZE00000007	CDS	73616564	73616578	+
GWHAAZE00000007	CDS	73616780	73616856	+
GWHAAZE00000007	CDS	73617049	73617110	+
GWHAAZE00000007	CDS	73618063	73618181	+
GWHAAZE00000007	CDS	73618262	73618429	+
GWHAAZE00000007	CDS	73619207	73619236	+

Transcript Sequence
>GWHTAAZE026142 ATGTATGAAGTTGATGATATTGATGGGACCGATGTTCCTCTTAGCAAATTTAAGGGCAAGGTTCTATTGATTGTCAACGTTGCTTCAAAATGTGGTTTGACGCAATCAAACTACTCAGAGCTATCTCACGTATATGAGAAGTACAAAACTCAAGGATTTGAAATTCTAGCATTCCCTTGCAATCAGTTTGGAGGCCAAGAGCCGGGATCGAATCCAGAGATTAAGCAGTTTGCTTGCACAAGGTTTAAAGCAGAATTCCCTATTTTTGACAAGGTTGATGTGAATGGGCCAACTACAGCTCCAGTTTACCAGTTCCTGAAGTCAAGTGCTGGAGGATTTTTAGGGGATCTGATAAAATGGAATTTTGAGAAGTTTTTGGTGGACAAAAATGGCATAGTTGTTGAAAGATACCCACCAACAACATCGCCATTTCAAATAGAGAAGGACATCCAGAAGCTCCTTGCAGCATGA

Network for GWHGAAZE026108

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00255.20	GSHPx	2	107	1.60E-41

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00432	gpx, btuE, bsaA	Metabolic pathways	map01100
		Arachidonic acid metabolism	map00590
		Glutathione metabolism	map00480
		Thyroid hormone synthesis	map04918

Gene Ontology

GO term	Ontology	Name
GO:0006979	biological_process	response to oxidative stress
GO:0055114	biological_process	oxidation-reduction process
GO:0004602	molecular_function	glutathione peroxidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	100.857
	SRR3591706	second leaf	131.880
	SRR3591707	mature leaf	279.855
	SRR3591708	Shoot apex	92.378
	SRR3591709	Stem	100.391
	SRR3591710	White floral bud	196.960
	SRR3591711	White flower	304.990
	SRR3591712	Green floral bud	208.073
	SRR3591713	Yellow flower	422.361
SRP173429	SRR8316895	Juvenile bud stage	124.260
	SRR8316896	Juvenile bud stage	160.125
	SRR8316897	Juvenile bud stage	74.636
	SRR8316894	Third green stage	66.765
	SRR8316900	Third green stage	275.224
	SRR8316901	Third green stage	242.040
	SRR8316898	Complete white stage	178.693
	SRR8316899	Complete white stage	357.098
	SRR8316903	Complete white stage	213.230
	SRR8316902	Silver flowering stage	215.439
	SRR8316904	Silver flowering stage	266.041
	SRR8316905	Silver flowering stage	131.493
	SRR8316906	Gold flowering stage	542.040
	SRR8316907	Gold flowering stage	483.092
	SRR8316908	Gold flowering stage	487.158
SRP132670	SRR6706286	Control	73.896
	SRR6706287	Light intensity 50%	101.814
	SRR6706288	Light intensity 20%	104.704
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	126.586
	CNS0095593	Slightly white alabastrum(diploid) 2	109.337
	CNS0095594	Slightly white alabastrum(diploid) 3	108.667
	CNS0095595	Whole white alabastrum(diploid) 2	125.297
	CNS0095596	Whole white alabastrum(diploid) 3	146.041
	CNS0095597	Whole white alabastrum(diploid) 4	139.939
	CNS0095598	Silvery flower (diploied) 1	207.023
	CNS0095599	Silvery flower (diploied) 2	214.745
	CNS0095600	Silvery flower (diploied) 3	390.565
	CNS0095601	Golden flower (diploid) 1	240.512
	CNS0095602	Golden flower (diploid) 2	403.825
	CNS0095603	Golden flower (diploid) 3	380.599
	CNS0095604	Slightly white alabastrum(tetraploid) 1	133.637
	CNS0095605	Slightly white alabastrum(tetraploid) 2	119.874
	CNS0095606	Slightly white alabastrum(tetraploid) 3	174.001
	CNS0095607	Whole white alabastrum(tetraploid) 1	74.096
	CNS0095608	Whole white alabastrum(tetraploid) 2	114.445
	CNS0095609	Whole white alabastrum(tetraploid) 3	231.851
	CNS0095610	Silvery flower (tetraploid) 1	417.565
	CNS0095611	Silvery flower (tetraploid) 2	531.199
	CNS0095612	Silvery flower (tetraploid) 3	493.756
	CNS0095613	Golden flower (tetraploid) 1	496.398
	CNS0095614	Golden flower (tetraploid) 2	488.088
	CNS0095615	Golden flower (tetraploid) 3	594.097
CRA001975	CRR073297	Stem 1	107.774
	CRR073298	Stem 2	94.286
	CRR073299	Stem 3	114.532
	CRR073300	Leaf 1	112.641
	CRR073301	Leaf 2	100.638
	CRR073302	Leaf 3	132.199
	CRR073303	Juvenile bud 1	162.423
	CRR073304	Juvenile bud 2	181.861
	CRR073305	Juvenile bud 3	182.328
	CRR073306	Third green 1	161.125
	CRR073307	Third green 2	121.152
	CRR073308	Third green 3	130.958
	CRR073309	Second white 1	344.804
	CRR073310	Second white 2	287.943
	CRR073311	Second white 3	227.775
	CRR073312	Silver flowering 1	274.013
	CRR073313	Silver flowering 2	275.669
	CRR073314	Silver flowering 3	225.088
	CRR073315	Gold flowering 1	277.871
	CRR073316	Gold flowering 2	300.337
	CRR073317	Gold flowering 3	278.639
	CRR073318	Tawny withering 1	45.320
	CRR073319	Tawny withering 2	79.791
	CRR073320	Tawny withering 3	66.196