Gene detail

Detail information of GWHGAAZE026388

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008230105.1	3.88669E-97	PREDICTED: SPX and EXS domain-containing protein 1-like isoform X4 [Prunus mume]
trEMBL	tr\|A0A068UG51\|A0A068UG51_COFCA	2E-97	Coffea canephora DH200=94 genomic scaffold, scaffold_26 {ECO:0000313\|EMBL:CDP07550.1}
TAIR10	AT5G35730.1	8E-60	EXS (ERD1/XPR1/SYG1) family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	3768095	3769838	+
GWHAAZE00000008	mRNA	3768095	3769838	+
GWHAAZE00000008	exon	3768095	3768176	+
GWHAAZE00000008	exon	3768557	3768690	+
GWHAAZE00000008	exon	3769312	3769404	+
GWHAAZE00000008	exon	3769489	3769605	+
GWHAAZE00000008	exon	3769737	3769838	+
GWHAAZE00000008	CDS	3768095	3768176	+
GWHAAZE00000008	CDS	3768557	3768690	+
GWHAAZE00000008	CDS	3769312	3769404	+
GWHAAZE00000008	CDS	3769489	3769605	+
GWHAAZE00000008	CDS	3769737	3769838	+

Transcript Sequence
>GWHTAAZE026422 ATGTTTGGAGGTCATGTGACTGTTCCTGCCAACAGTCCACATCTACGGAAGTCAGGAAGCAGGCCTGTTGTTTCTGATCTAGTTATCAGTGACCTTGGAAATAGCGCTGAAGAAGCTTTCTTGCATTCAGTAGAGTTGAATGAAATGAAGGCCGTAACAACACCATTGAGCAGTGCTGCAATACTGCCGTCTCCTACTTTGTTATGGAGACTTAAGTTTGGATGGGATTCTGTCATGAGAATGAGTGTGGACCTGCGGGATCTATTTTTATACGAGGCTTTTTTGTATTATAATCCTCTTCTTCTCGTGACGGTGATGGTTTGGCTATGGGGAGTAAATTTATGGGTCTTTGCTCAATCTACTGTCAATTATGCTAAAATTTTTGACCTCGATCAAAATCACCTTACTCACAGAGAAATATGGAAGTGTGCCACCTGGATGACAATTATTGTCCCAACTAGCATGACCTCATATCTTTATCTTTATTCTCATGGAGAAGTTTCTCTGGCTGCATTCCAACCTGTGTAA

Network for GWHGAAZE026388

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0186

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03124.15	EXS	94	164	7.00E-13

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0016021	cellular_component	integral component of membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	30.423
	SRR3591706	second leaf	10.658
	SRR3591707	mature leaf	7.038
	SRR3591708	Shoot apex	13.154
	SRR3591709	Stem	21.766
	SRR3591710	White floral bud	17.409
	SRR3591711	White flower	14.381
	SRR3591712	Green floral bud	20.945
	SRR3591713	Yellow flower	14.107
SRP173429	SRR8316895	Juvenile bud stage	11.439
	SRR8316896	Juvenile bud stage	16.598
	SRR8316897	Juvenile bud stage	8.529
	SRR8316894	Third green stage	7.814
	SRR8316900	Third green stage	24.633
	SRR8316901	Third green stage	18.379
	SRR8316898	Complete white stage	7.499
	SRR8316899	Complete white stage	21.293
	SRR8316903	Complete white stage	14.426
	SRR8316902	Silver flowering stage	6.011
	SRR8316904	Silver flowering stage	9.237
	SRR8316905	Silver flowering stage	3.626
	SRR8316906	Gold flowering stage	10.016
	SRR8316907	Gold flowering stage	9.094
	SRR8316908	Gold flowering stage	14.121
SRP132670	SRR6706286	Control	11.488
	SRR6706287	Light intensity 50%	12.673
	SRR6706288	Light intensity 20%	14.818
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	13.382
	CNS0095593	Slightly white alabastrum(diploid) 2	7.413
	CNS0095594	Slightly white alabastrum(diploid) 3	9.508
	CNS0095595	Whole white alabastrum(diploid) 2	22.021
	CNS0095596	Whole white alabastrum(diploid) 3	18.663
	CNS0095597	Whole white alabastrum(diploid) 4	17.621
	CNS0095598	Silvery flower (diploied) 1	7.190
	CNS0095599	Silvery flower (diploied) 2	7.084
	CNS0095600	Silvery flower (diploied) 3	18.192
	CNS0095601	Golden flower (diploid) 1	6.215
	CNS0095602	Golden flower (diploid) 2	15.428
	CNS0095603	Golden flower (diploid) 3	13.566
	CNS0095604	Slightly white alabastrum(tetraploid) 1	25.218
	CNS0095605	Slightly white alabastrum(tetraploid) 2	16.615
	CNS0095606	Slightly white alabastrum(tetraploid) 3	22.916
	CNS0095607	Whole white alabastrum(tetraploid) 1	22.156
	CNS0095608	Whole white alabastrum(tetraploid) 2	19.495
	CNS0095609	Whole white alabastrum(tetraploid) 3	27.108
	CNS0095610	Silvery flower (tetraploid) 1	15.015
	CNS0095611	Silvery flower (tetraploid) 2	12.521
	CNS0095612	Silvery flower (tetraploid) 3	16.437
	CNS0095613	Golden flower (tetraploid) 1	4.096
	CNS0095614	Golden flower (tetraploid) 2	9.852
	CNS0095615	Golden flower (tetraploid) 3	9.837
CRA001975	CRR073297	Stem 1	12.413
	CRR073298	Stem 2	11.098
	CRR073299	Stem 3	12.061
	CRR073300	Leaf 1	17.196
	CRR073301	Leaf 2	14.911
	CRR073302	Leaf 3	16.718
	CRR073303	Juvenile bud 1	15.914
	CRR073304	Juvenile bud 2	16.662
	CRR073305	Juvenile bud 3	13.589
	CRR073306	Third green 1	7.790
	CRR073307	Third green 2	4.355
	CRR073308	Third green 3	9.599
	CRR073309	Second white 1	7.490
	CRR073310	Second white 2	7.823
	CRR073311	Second white 3	6.074
	CRR073312	Silver flowering 1	5.074
	CRR073313	Silver flowering 2	5.024
	CRR073314	Silver flowering 3	4.572
	CRR073315	Gold flowering 1	1.716
	CRR073316	Gold flowering 2	6.969
	CRR073317	Gold flowering 3	1.855
	CRR073318	Tawny withering 1	15.682
	CRR073319	Tawny withering 2	6.064
	CRR073320	Tawny withering 3	17.246