Gene detail

Detail information of GWHGAAZE026395

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP25599.1	4.415E-84	hypothetical protein JCGZ_20755 [Jatropha curcas]
COG	YP_007118813.1	2E-16	putative signal transduction protein with EFhand domain
Swissprot	tr\|Q8VZ50\|CML14_ARATH	1E-81	Probable calcium-binding protein CML14
trEMBL	tr\|A0A067K1D2\|A0A067K1D2_JATCU	2E-84	Uncharacterized protein {ECO:0000313\|EMBL:KDP25599.1}
TAIR10	AT1G62820.1	2E-64	Calcium-binding EF-hand family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	3865425	3865853	+
GWHAAZE00000008	mRNA	3865425	3865853	+
GWHAAZE00000008	exon	3865425	3865853	+
GWHAAZE00000008	CDS	3865425	3865853	+

Transcript Sequence
>GWHTAAZE026429 ATGAACAACGATCAAGTCGCCGCAATGAAGGAGGCGTTCACTCTCTTCGACACCGATGGCGACGGCAAGATCGCACCGACGGAGCTCGGAATCCTCATGCGATCGCTCGGCGGTAACCCTACGCAAGCACAAATCAAAACAATCGTCAACGAGGAGAATTTGAAAGCTCCGTTTGATTTCCCTCGATTTATGGACCTAATGGGGAAGCATCTCAAGCCGGAGCCCTTTGATCGCCAACTTCGAGAAGCATTCAGGGTGATTGATAAGGACGGGACTGGATTTGTTGCCGTCGGAGATCTCAGGCATATTTTGACTAGTATTGGGGAGAAGCTTGAGCCGGCGGAGTTCGATGAGTGGATCAAGGAGGTGGACGTTAATGATGGGAAGATTAAGTATGAGGATTTTATTACTAGGATGAGTGCAAAGTAA

Network for GWHGAAZE026395

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13405.7	EF-hand_6	9	37	1.60E-06
PF13499.7	EF-hand_7	78	139	1.10E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	10.805
	SRR3591706	second leaf	4.359
	SRR3591707	mature leaf	1.788
	SRR3591708	Shoot apex	6.631
	SRR3591709	Stem	10.645
	SRR3591710	White floral bud	48.432
	SRR3591711	White flower	10.029
	SRR3591712	Green floral bud	74.657
	SRR3591713	Yellow flower	5.240
SRP173429	SRR8316895	Juvenile bud stage	14.300
	SRR8316896	Juvenile bud stage	37.614
	SRR8316897	Juvenile bud stage	13.924
	SRR8316894	Third green stage	13.527
	SRR8316900	Third green stage	68.502
	SRR8316901	Third green stage	65.333
	SRR8316898	Complete white stage	18.744
	SRR8316899	Complete white stage	36.038
	SRR8316903	Complete white stage	16.524
	SRR8316902	Silver flowering stage	5.303
	SRR8316904	Silver flowering stage	8.099
	SRR8316905	Silver flowering stage	4.046
	SRR8316906	Gold flowering stage	8.308
	SRR8316907	Gold flowering stage	7.278
	SRR8316908	Gold flowering stage	6.113
SRP132670	SRR6706286	Control	68.344
	SRR6706287	Light intensity 50%	61.515
	SRR6706288	Light intensity 20%	57.584
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	56.181
	CNS0095593	Slightly white alabastrum(diploid) 2	57.450
	CNS0095594	Slightly white alabastrum(diploid) 3	59.291
	CNS0095595	Whole white alabastrum(diploid) 2	66.602
	CNS0095596	Whole white alabastrum(diploid) 3	93.307
	CNS0095597	Whole white alabastrum(diploid) 4	60.413
	CNS0095598	Silvery flower (diploied) 1	25.289
	CNS0095599	Silvery flower (diploied) 2	26.581
	CNS0095600	Silvery flower (diploied) 3	14.132
	CNS0095601	Golden flower (diploid) 1	21.210
	CNS0095602	Golden flower (diploid) 2	11.382
	CNS0095603	Golden flower (diploid) 3	14.782
	CNS0095604	Slightly white alabastrum(tetraploid) 1	66.570
	CNS0095605	Slightly white alabastrum(tetraploid) 2	59.502
	CNS0095606	Slightly white alabastrum(tetraploid) 3	15.121
	CNS0095607	Whole white alabastrum(tetraploid) 1	103.361
	CNS0095608	Whole white alabastrum(tetraploid) 2	104.379
	CNS0095609	Whole white alabastrum(tetraploid) 3	76.575
	CNS0095610	Silvery flower (tetraploid) 1	6.027
	CNS0095611	Silvery flower (tetraploid) 2	9.954
	CNS0095612	Silvery flower (tetraploid) 3	10.056
	CNS0095613	Golden flower (tetraploid) 1	3.858
	CNS0095614	Golden flower (tetraploid) 2	6.330
	CNS0095615	Golden flower (tetraploid) 3	7.361
CRA001975	CRR073297	Stem 1	31.692
	CRR073298	Stem 2	38.957
	CRR073299	Stem 3	30.545
	CRR073300	Leaf 1	54.061
	CRR073301	Leaf 2	65.099
	CRR073302	Leaf 3	60.147
	CRR073303	Juvenile bud 1	71.367
	CRR073304	Juvenile bud 2	89.487
	CRR073305	Juvenile bud 3	34.781
	CRR073306	Third green 1	34.783
	CRR073307	Third green 2	65.262
	CRR073308	Third green 3	41.359
	CRR073309	Second white 1	3.021
	CRR073310	Second white 2	6.510
	CRR073311	Second white 3	4.707
	CRR073312	Silver flowering 1	8.823
	CRR073313	Silver flowering 2	9.936
	CRR073314	Silver flowering 3	6.740
	CRR073315	Gold flowering 1	15.568
	CRR073316	Gold flowering 2	6.388
	CRR073317	Gold flowering 3	10.255
	CRR073318	Tawny withering 1	39.902
	CRR073319	Tawny withering 2	35.920
	CRR073320	Tawny withering 3	43.447