Gene detail

Detail information of GWHGAAZE026396

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011101131.1	1.94494E-92	PREDICTED: 40S ribosomal protein S13-like [Sesamum indicum]
COG	YP_183664.1	1E-40	30S ribosomal protein S15
Swissprot	tr\|P62302\|RS13_SOYBN	4E-92	40S ribosomal protein S13
trEMBL	tr\|A0A022QWM7\|A0A022QWM7_ERYGU	9E-93	Uncharacterized protein {ECO:0000313\|EMBL:EYU31984.1}
TAIR10	AT4G00100.1	6E-70	ribosomal protein S13A

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	3869188	3870883	+
GWHAAZE00000008	mRNA	3869188	3870883	+
GWHAAZE00000008	exon	3869188	3869197	+
GWHAAZE00000008	exon	3869472	3869526	+
GWHAAZE00000008	exon	3869650	3869722	+
GWHAAZE00000008	exon	3870464	3870602	+
GWHAAZE00000008	exon	3870696	3870883	+
GWHAAZE00000008	CDS	3869188	3869197	+
GWHAAZE00000008	CDS	3869472	3869526	+
GWHAAZE00000008	CDS	3869650	3869722	+
GWHAAZE00000008	CDS	3870464	3870602	+
GWHAAZE00000008	CDS	3870696	3870883	+

Transcript Sequence
>GWHTAAZE026430 ATGTCAAAAGCTAAGCAGCAGAGTTCTTCCGCCTCCGCCACCATGGGTCGCATGCACAGTAAAGGTAAGGGTATATCGGCGTCTTGTCTGCCGTACAAGAGAACTCCGGCCAGTTGGCTTAAGATCACCGCCCCTGATGTTGAAGAGAACATCTGCAAGTTCGCCAAGAGAGGTATGACCCCCTCACAGATTGGTGTCATTCTTCGTGACTCTCACGGTATTGCTCAGGTCAAGTACGTTACTGGAAGCAAGATCTTGCGTATCCTCAAAGCTCATGGGCTTGCTCCTGAAATTCCCGAGGATCTTTACCACCTGATCAAGAAGGCAGTTGCCATTCGCAAACATCTGGAGAGGAACAGGAAGGACAAGGACTCCAAGTTCCGTTTGATTCTTGTTGAGAGCAGGATCCACCGTTTGGCTCGCTACTACAAGAAAACCAAGAAGCTTCCTCCTGTCTGGAAATAG

Network for GWHGAAZE026396

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF08069.13	Ribosomal_S13_N	15	74	5.30E-29
PF00312.23	Ribosomal_S15	88	148	4.00E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02953	RP-S13e, RPS13	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	578.760
	SRR3591706	second leaf	204.294
	SRR3591707	mature leaf	146.740
	SRR3591708	Shoot apex	681.822
	SRR3591709	Stem	374.405
	SRR3591710	White floral bud	254.969
	SRR3591711	White flower	258.108
	SRR3591712	Green floral bud	569.527
	SRR3591713	Yellow flower	173.033
SRP173429	SRR8316895	Juvenile bud stage	214.983
	SRR8316896	Juvenile bud stage	340.752
	SRR8316897	Juvenile bud stage	182.165
	SRR8316894	Third green stage	140.580
	SRR8316900	Third green stage	435.052
	SRR8316901	Third green stage	390.885
	SRR8316898	Complete white stage	55.022
	SRR8316899	Complete white stage	409.005
	SRR8316903	Complete white stage	106.450
	SRR8316902	Silver flowering stage	50.273
	SRR8316904	Silver flowering stage	50.754
	SRR8316905	Silver flowering stage	26.157
	SRR8316906	Gold flowering stage	95.971
	SRR8316907	Gold flowering stage	95.143
	SRR8316908	Gold flowering stage	115.748
SRP132670	SRR6706286	Control	501.388
	SRR6706287	Light intensity 50%	516.943
	SRR6706288	Light intensity 20%	568.597
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	427.241
	CNS0095593	Slightly white alabastrum(diploid) 2	523.795
	CNS0095594	Slightly white alabastrum(diploid) 3	420.274
	CNS0095595	Whole white alabastrum(diploid) 2	396.200
	CNS0095596	Whole white alabastrum(diploid) 3	445.781
	CNS0095597	Whole white alabastrum(diploid) 4	356.918
	CNS0095598	Silvery flower (diploied) 1	221.079
	CNS0095599	Silvery flower (diploied) 2	198.037
	CNS0095600	Silvery flower (diploied) 3	164.462
	CNS0095601	Golden flower (diploid) 1	211.658
	CNS0095602	Golden flower (diploid) 2	182.329
	CNS0095603	Golden flower (diploid) 3	194.621
	CNS0095604	Slightly white alabastrum(tetraploid) 1	502.519
	CNS0095605	Slightly white alabastrum(tetraploid) 2	488.550
	CNS0095606	Slightly white alabastrum(tetraploid) 3	589.027
	CNS0095607	Whole white alabastrum(tetraploid) 1	310.947
	CNS0095608	Whole white alabastrum(tetraploid) 2	274.806
	CNS0095609	Whole white alabastrum(tetraploid) 3	497.280
	CNS0095610	Silvery flower (tetraploid) 1	155.166
	CNS0095611	Silvery flower (tetraploid) 2	172.409
	CNS0095612	Silvery flower (tetraploid) 3	130.192
	CNS0095613	Golden flower (tetraploid) 1	81.305
	CNS0095614	Golden flower (tetraploid) 2	109.401
	CNS0095615	Golden flower (tetraploid) 3	72.189
CRA001975	CRR073297	Stem 1	480.883
	CRR073298	Stem 2	505.498
	CRR073299	Stem 3	598.630
	CRR073300	Leaf 1	626.564
	CRR073301	Leaf 2	644.052
	CRR073302	Leaf 3	661.251
	CRR073303	Juvenile bud 1	675.324
	CRR073304	Juvenile bud 2	493.650
	CRR073305	Juvenile bud 3	630.396
	CRR073306	Third green 1	82.736
	CRR073307	Third green 2	76.719
	CRR073308	Third green 3	92.496
	CRR073309	Second white 1	88.084
	CRR073310	Second white 2	75.531
	CRR073311	Second white 3	47.523
	CRR073312	Silver flowering 1	68.206
	CRR073313	Silver flowering 2	115.041
	CRR073314	Silver flowering 3	72.781
	CRR073315	Gold flowering 1	200.833
	CRR073316	Gold flowering 2	233.567
	CRR073317	Gold flowering 3	246.583
	CRR073318	Tawny withering 1	486.729
	CRR073319	Tawny withering 2	416.844
	CRR073320	Tawny withering 3	375.782