Gene detail

Detail information of GWHGAAZE026402

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011076325.1	7.5073E-100	PREDICTED: UMP-CMP kinase isoform X1 [Sesamum indicum]
COG	YP_004368550.1	1E-36	adenylate kinase
Swissprot	tr\|O24464\|KCY_PRUAR	1E-93	UMP-CMP kinase {ECO:0000255\|HAMAP-Rule:MF_03172}
trEMBL	tr\|A0A068UAU8\|A0A068UAU8_COFCA	5E-97	Coffea canephora DH200=94 genomic scaffold, scaffold_15 {ECO:0000313\|EMBL:CDP05314.1}
TAIR10	AT4G25280.1	1E-73	P-loop containing nucleoside triphosphate hydrolases superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	4002929	4004512	+
GWHAAZE00000008	mRNA	4002929	4004512	+
GWHAAZE00000008	exon	4002929	4003056	+
GWHAAZE00000008	exon	4003128	4003284	+
GWHAAZE00000008	exon	4003502	4003582	+
GWHAAZE00000008	exon	4003680	4003787	+
GWHAAZE00000008	exon	4004063	4004127	+
GWHAAZE00000008	exon	4004503	4004512	+
GWHAAZE00000008	CDS	4002929	4003056	+
GWHAAZE00000008	CDS	4003128	4003284	+
GWHAAZE00000008	CDS	4003502	4003582	+
GWHAAZE00000008	CDS	4003680	4003787	+
GWHAAZE00000008	CDS	4004063	4004127	+
GWHAAZE00000008	CDS	4004503	4004512	+

Transcript Sequence
>GWHTAAZE026436 ATGTTTTCAGGAGGCCCTGGTAGTGGAAAAGGTACACAATGTGCAAAAATTGCTGAGACTTTTGGTTTCACTCACCTAAGTGCTGGAGATCTGCTAAGGAAGGAAATATTATCTAATAGTGAAAATGGTGCCATGATTCTCAACAAAATCAAGAAAGGGAAAATTGTTCCTTCAGAGATGACCATCAACCTGATCCAAAGGGAAATTGAATCCAGCGAAGGTAATAAATTCCTCATTGATGGTTTCCCAAGAAGTGAAGAGAACCGCATTACATATGAACGTATTATTGGAAAAGAACCAAACATTGTGTGTTTTTTTGATTTGCCCGAAGAAGAGATGGTGAAACGAGTGCTAGGCCGTAATCAGGGTAGAATTGATGATAATATCGATACAGTGAAGGAACGCCTGAAAGTATTTACATCTTTAAATCTCCCTGTTGTTGACTACTACTCTGAAAAGGGAAAACTTTACAAGATCAATGCGCTAGGAACTGTAGATGAGATATTTGAACGAGTTCGGCCTATTTTTGCTTCATTGAGTGAGCGATGA

Network for GWHGAAZE026402

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00406.23	ADK	3	154	1.40E-44

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13800	CMPK1, UMPK	Metabolic pathways	map01100
		Pyrimidine metabolism	map00240
		Drug metabolism - other enzymes	map00983

Gene Ontology

GO term	Ontology	Name
GO:0006207	biological_process	'de novo' pyrimidine nucleobase biosynthetic process
GO:0006221	biological_process	pyrimidine nucleotide biosynthetic process
GO:0006139	biological_process	nucleobase-containing compound metabolic process
GO:0004127	molecular_function	cytidylate kinase activity
GO:0009041	molecular_function	uridylate kinase activity
GO:0005524	molecular_function	ATP binding
GO:0019205	molecular_function	nucleobase-containing compound kinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	5.158
	SRR3591706	second leaf	5.159
	SRR3591707	mature leaf	4.553
	SRR3591708	Shoot apex	10.600
	SRR3591709	Stem	3.895
	SRR3591710	White floral bud	20.489
	SRR3591711	White flower	11.235
	SRR3591712	Green floral bud	23.437
	SRR3591713	Yellow flower	14.805
SRP173429	SRR8316895	Juvenile bud stage	17.246
	SRR8316896	Juvenile bud stage	28.769
	SRR8316897	Juvenile bud stage	11.356
	SRR8316894	Third green stage	8.722
	SRR8316900	Third green stage	22.322
	SRR8316901	Third green stage	23.625
	SRR8316898	Complete white stage	9.217
	SRR8316899	Complete white stage	18.483
	SRR8316903	Complete white stage	10.385
	SRR8316902	Silver flowering stage	5.061
	SRR8316904	Silver flowering stage	9.092
	SRR8316905	Silver flowering stage	5.413
	SRR8316906	Gold flowering stage	15.218
	SRR8316907	Gold flowering stage	13.904
	SRR8316908	Gold flowering stage	16.227
SRP132670	SRR6706286	Control	4.979
	SRR6706287	Light intensity 50%	5.674
	SRR6706288	Light intensity 20%	6.414
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	22.360
	CNS0095593	Slightly white alabastrum(diploid) 2	23.858
	CNS0095594	Slightly white alabastrum(diploid) 3	26.896
	CNS0095595	Whole white alabastrum(diploid) 2	19.035
	CNS0095596	Whole white alabastrum(diploid) 3	24.154
	CNS0095597	Whole white alabastrum(diploid) 4	23.485
	CNS0095598	Silvery flower (diploied) 1	9.262
	CNS0095599	Silvery flower (diploied) 2	12.535
	CNS0095600	Silvery flower (diploied) 3	7.397
	CNS0095601	Golden flower (diploid) 1	8.800
	CNS0095602	Golden flower (diploid) 2	6.027
	CNS0095603	Golden flower (diploid) 3	7.300
	CNS0095604	Slightly white alabastrum(tetraploid) 1	30.307
	CNS0095605	Slightly white alabastrum(tetraploid) 2	24.161
	CNS0095606	Slightly white alabastrum(tetraploid) 3	16.623
	CNS0095607	Whole white alabastrum(tetraploid) 1	21.623
	CNS0095608	Whole white alabastrum(tetraploid) 2	21.024
	CNS0095609	Whole white alabastrum(tetraploid) 3	20.475
	CNS0095610	Silvery flower (tetraploid) 1	8.983
	CNS0095611	Silvery flower (tetraploid) 2	9.855
	CNS0095612	Silvery flower (tetraploid) 3	9.738
	CNS0095613	Golden flower (tetraploid) 1	5.343
	CNS0095614	Golden flower (tetraploid) 2	8.916
	CNS0095615	Golden flower (tetraploid) 3	3.985
CRA001975	CRR073297	Stem 1	6.497
	CRR073298	Stem 2	5.926
	CRR073299	Stem 3	6.639
	CRR073300	Leaf 1	5.714
	CRR073301	Leaf 2	7.625
	CRR073302	Leaf 3	4.787
	CRR073303	Juvenile bud 1	4.163
	CRR073304	Juvenile bud 2	3.273
	CRR073305	Juvenile bud 3	3.373
	CRR073306	Third green 1	3.415
	CRR073307	Third green 2	1.062
	CRR073308	Third green 3	2.416
	CRR073309	Second white 1	3.019
	CRR073310	Second white 2	1.252
	CRR073311	Second white 3	1.178
	CRR073312	Silver flowering 1	0.024
	CRR073313	Silver flowering 2	0.650
	CRR073314	Silver flowering 3	1.205
	CRR073315	Gold flowering 1	1.481
	CRR073316	Gold flowering 2	2.418
	CRR073317	Gold flowering 3	1.924
	CRR073318	Tawny withering 1	1.642
	CRR073319	Tawny withering 2	7.039
	CRR073320	Tawny withering 3	3.543