Gene detail

Detail information of GWHGAAZE026463

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004508270.1	2.27415E-97	PREDICTED: uncharacterized protein LOC101493781 [Cicer arietinum]
COG	YP_007202898.1	4E-19	pterin-4a-carbinolamine dehydratase
trEMBL	tr\|F6I2K2\|F6I2K2_VITVI	2E-96	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB61169.1}
TAIR10	AT5G51110.1	9E-64	Transcriptional coactivator/pterin dehydratase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	5042811	5045480	+
GWHAAZE00000008	mRNA	5042811	5045480	+
GWHAAZE00000008	exon	5042811	5043029	+
GWHAAZE00000008	exon	5044638	5044830	+
GWHAAZE00000008	exon	5045389	5045480	+
GWHAAZE00000008	CDS	5042811	5043029	+
GWHAAZE00000008	CDS	5044638	5044830	+
GWHAAZE00000008	CDS	5045389	5045480	+

Transcript Sequence
>GWHTAAZE026497 ATGGCCGACGACAAGTTGGGTGATTTCGGTGCCCGGGACCCATTTCCGGCAGAGTTAGAGAGTGGGTTTGGTGAGAAGGTTTTGGGTAACTTTAACACTGAGCACAAAATCTTGATTCCTAATTTGGCTGCTCTCTCTCTTGCCCAATTGGATTGCACTTCTCTTTCTCCTTCGCAGCCTCCCATGTCTGAAGAACAGGCTAATCAGCTGTTGAGGAAGGTGATTGGGTGGAGACTGATTAATGAAGACGGGATACTAAAGCTGCAATGCTTGTGGAAACTAAGGGACTTCAAATGTGGAGTTGAACTTATCAATAGGATATATAATGTTGTAGAATCTGAAGGGCATTTCCCTAATCTTCATCTGGAACAGCCCAATCAAATTCGAGCCCAACTATGGACTGCTTCGATTGGAGGGTTGAGTATGAATGACTTCATTGTGGCTGCTAAAATAGATGAGATAAGAACATCAGATCTTGTTCCCAAAAAGAGAGTTTGGGCTTAA

Network for GWHGAAZE026463

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01329.20	Pterin_4a	61	154	2.50E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01724	PCBD, phhB	Metabolic pathways	map01100
K01724	PCBD, phhB	Folate biosynthesis	map00790

Gene Ontology

GO term	Ontology	Name
GO:0006729	biological_process	tetrahydrobiopterin biosynthetic process
GO:0008124	molecular_function	4-alpha-hydroxytetrahydrobiopterin dehydratase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	50.791
	SRR3591706	second leaf	97.640
	SRR3591707	mature leaf	64.663
	SRR3591708	Shoot apex	74.731
	SRR3591709	Stem	22.189
	SRR3591710	White floral bud	32.192
	SRR3591711	White flower	32.200
	SRR3591712	Green floral bud	32.768
	SRR3591713	Yellow flower	32.467
SRP173429	SRR8316895	Juvenile bud stage	36.977
	SRR8316896	Juvenile bud stage	37.006
	SRR8316897	Juvenile bud stage	31.432
	SRR8316894	Third green stage	20.162
	SRR8316900	Third green stage	87.189
	SRR8316901	Third green stage	67.941
	SRR8316898	Complete white stage	39.900
	SRR8316899	Complete white stage	68.631
	SRR8316903	Complete white stage	52.740
	SRR8316902	Silver flowering stage	33.548
	SRR8316904	Silver flowering stage	47.555
	SRR8316905	Silver flowering stage	27.803
	SRR8316906	Gold flowering stage	83.126
	SRR8316907	Gold flowering stage	85.139
	SRR8316908	Gold flowering stage	75.862
SRP132670	SRR6706286	Control	62.390
	SRR6706287	Light intensity 50%	65.245
	SRR6706288	Light intensity 20%	71.012
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	29.771
	CNS0095593	Slightly white alabastrum(diploid) 2	29.296
	CNS0095594	Slightly white alabastrum(diploid) 3	28.731
	CNS0095595	Whole white alabastrum(diploid) 2	31.885
	CNS0095596	Whole white alabastrum(diploid) 3	44.437
	CNS0095597	Whole white alabastrum(diploid) 4	31.665
	CNS0095598	Silvery flower (diploied) 1	60.354
	CNS0095599	Silvery flower (diploied) 2	63.856
	CNS0095600	Silvery flower (diploied) 3	75.889
	CNS0095601	Golden flower (diploid) 1	49.476
	CNS0095602	Golden flower (diploid) 2	56.667
	CNS0095603	Golden flower (diploid) 3	52.834
	CNS0095604	Slightly white alabastrum(tetraploid) 1	31.363
	CNS0095605	Slightly white alabastrum(tetraploid) 2	32.237
	CNS0095606	Slightly white alabastrum(tetraploid) 3	42.868
	CNS0095607	Whole white alabastrum(tetraploid) 1	19.857
	CNS0095608	Whole white alabastrum(tetraploid) 2	24.535
	CNS0095609	Whole white alabastrum(tetraploid) 3	49.494
	CNS0095610	Silvery flower (tetraploid) 1	66.141
	CNS0095611	Silvery flower (tetraploid) 2	66.745
	CNS0095612	Silvery flower (tetraploid) 3	69.198
	CNS0095613	Golden flower (tetraploid) 1	46.131
	CNS0095614	Golden flower (tetraploid) 2	55.790
	CNS0095615	Golden flower (tetraploid) 3	48.380
CRA001975	CRR073297	Stem 1	57.376
	CRR073298	Stem 2	52.591
	CRR073299	Stem 3	69.858
	CRR073300	Leaf 1	47.558
	CRR073301	Leaf 2	50.285
	CRR073302	Leaf 3	66.575
	CRR073303	Juvenile bud 1	70.298
	CRR073304	Juvenile bud 2	80.329
	CRR073305	Juvenile bud 3	56.452
	CRR073306	Third green 1	59.638
	CRR073307	Third green 2	42.961
	CRR073308	Third green 3	40.487
	CRR073309	Second white 1	90.706
	CRR073310	Second white 2	53.432
	CRR073311	Second white 3	46.997
	CRR073312	Silver flowering 1	52.086
	CRR073313	Silver flowering 2	48.244
	CRR073314	Silver flowering 3	60.225
	CRR073315	Gold flowering 1	170.714
	CRR073316	Gold flowering 2	188.761
	CRR073317	Gold flowering 3	187.883
	CRR073318	Tawny withering 1	34.274
	CRR073319	Tawny withering 2	37.549
	CRR073320	Tawny withering 3	37.304