Gene detail

Detail information of GWHGAAZE026562

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009369183.1	1.66309E-44	PREDICTED: anaphase-promoting complex subunit 1 isoform X2 [Pyrus x bretschneideri]
Swissprot	tr\|Q9FFF9\|APC1_ARATH	1E-34	Anaphase-promoting complex subunit 1
trEMBL	tr\|F6HCB6\|F6HCB6_VITVI	2E-44	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB49854.1}
TAIR10	AT5G05560.1	2E-23	E3 ubiquitin ligase, putative

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	6553395	6553775	+
GWHAAZE00000008	mRNA	6553395	6553775	+
GWHAAZE00000008	exon	6553395	6553775	+
GWHAAZE00000008	CDS	6553395	6553775	+

Transcript Sequence
>GWHTAAZE026596 ATGCAGCTAGCGCTAGCCTACAATGGAGCTCTACTCGATGGCAGATTAACAACTTCAAGAGGGAGCATCGTTCAATCTACATTTCTCAGCTCCCTTAAAAAGCGCGTTGAAGAGCTTCTAAGTTATTCTCCAAGCTTAAAGAACGATTTCTGCAACTACGCAAAATCGGGCAAATGGCCCGTTGAGGAGGCGGCTTCTATCATTCTATCATGGTATCTGCAGTGGTATGATGTGCCATCACATTCTGTAATTAAAAGAGCAGTTGAGAAAATCAAGCCTTGCTGGAAGTCTTCTTCTTCTTTGGTTCCTTTGCTGCGATTGCTACTGCCTAGAACTCACATTGATGCAATTTCCAAGATTGATAAATTATGGTTCGCTTAA

Network for GWHGAAZE026562

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF18122.2	APC1_C	3	79	4.10E-07

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03348	APC1	Ubiquitin mediated proteolysis	map04120
		Cell cycle	map04110
		Cell cycle - yeast	map04111
		Meiosis - yeast	map04113
		Oocyte meiosis	map04114
		Progesterone-mediated oocyte maturation	map04914

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	12.457
	SRR3591706	second leaf	5.395
	SRR3591707	mature leaf	4.902
	SRR3591708	Shoot apex	22.018
	SRR3591709	Stem	9.961
	SRR3591710	White floral bud	5.878
	SRR3591711	White flower	6.240
	SRR3591712	Green floral bud	13.523
	SRR3591713	Yellow flower	6.381
SRP173429	SRR8316895	Juvenile bud stage	6.288
	SRR8316896	Juvenile bud stage	10.129
	SRR8316897	Juvenile bud stage	4.962
	SRR8316894	Third green stage	3.586
	SRR8316900	Third green stage	10.893
	SRR8316901	Third green stage	7.385
	SRR8316898	Complete white stage	2.151
	SRR8316899	Complete white stage	7.326
	SRR8316903	Complete white stage	4.558
	SRR8316902	Silver flowering stage	3.367
	SRR8316904	Silver flowering stage	2.623
	SRR8316905	Silver flowering stage	0.355
	SRR8316906	Gold flowering stage	1.903
	SRR8316907	Gold flowering stage	3.381
	SRR8316908	Gold flowering stage	3.347
SRP132670	SRR6706286	Control	4.826
	SRR6706287	Light intensity 50%	2.979
	SRR6706288	Light intensity 20%	3.760
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	7.383
	CNS0095593	Slightly white alabastrum(diploid) 2	11.467
	CNS0095594	Slightly white alabastrum(diploid) 3	9.660
	CNS0095595	Whole white alabastrum(diploid) 2	5.837
	CNS0095596	Whole white alabastrum(diploid) 3	5.115
	CNS0095597	Whole white alabastrum(diploid) 4	6.378
	CNS0095598	Silvery flower (diploied) 1	9.016
	CNS0095599	Silvery flower (diploied) 2	8.247
	CNS0095600	Silvery flower (diploied) 3	5.018
	CNS0095601	Golden flower (diploid) 1	5.653
	CNS0095602	Golden flower (diploid) 2	2.703
	CNS0095603	Golden flower (diploid) 3	4.446
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.601
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.415
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.898
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.380
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.411
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.210
	CNS0095610	Silvery flower (tetraploid) 1	3.225
	CNS0095611	Silvery flower (tetraploid) 2	3.406
	CNS0095612	Silvery flower (tetraploid) 3	2.886
	CNS0095613	Golden flower (tetraploid) 1	2.855
	CNS0095614	Golden flower (tetraploid) 2	3.293
	CNS0095615	Golden flower (tetraploid) 3	2.158
CRA001975	CRR073297	Stem 1	5.042
	CRR073298	Stem 2	4.982
	CRR073299	Stem 3	3.482
	CRR073300	Leaf 1	6.961
	CRR073301	Leaf 2	4.214
	CRR073302	Leaf 3	5.270
	CRR073303	Juvenile bud 1	4.252
	CRR073304	Juvenile bud 2	3.752
	CRR073305	Juvenile bud 3	3.973
	CRR073306	Third green 1	1.668
	CRR073307	Third green 2	2.399
	CRR073308	Third green 3	3.324
	CRR073309	Second white 1	0.682
	CRR073310	Second white 2	0.813
	CRR073311	Second white 3	0.607
	CRR073312	Silver flowering 1	0.706
	CRR073313	Silver flowering 2	1.474
	CRR073314	Silver flowering 3	0.707
	CRR073315	Gold flowering 1	1.955
	CRR073316	Gold flowering 2	4.318
	CRR073317	Gold flowering 3	1.883
	CRR073318	Tawny withering 1	6.489
	CRR073319	Tawny withering 2	11.021
	CRR073320	Tawny withering 3	9.914