Gene detail

Detail information of GWHGAAZE026693

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002284071.1	3.7074E-150	PREDICTED: ras-related protein RABE1c [Vitis vinifera]
COG	YP_008431664.1	5E-30	hypothetical protein N186_01315
Swissprot	tr\|O24466\|RAE1A_ARATH	6E-142	Ras-related protein RABE1a
trEMBL	tr\|D7TLX7\|D7TLX7_VITVI	1E-150	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI31714.3}
TAIR10	AT3G53610.3	4E-96	RAB GTPase homolog 8

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	8742780	8747346	+
GWHAAZE00000008	mRNA	8742780	8747346	+
GWHAAZE00000008	exon	8742780	8742852	+
GWHAAZE00000008	exon	8744615	8744687	+
GWHAAZE00000008	exon	8745002	8745102	+
GWHAAZE00000008	exon	8745488	8745553	+
GWHAAZE00000008	exon	8745992	8746089	+
GWHAAZE00000008	exon	8746570	8746632	+
GWHAAZE00000008	exon	8746714	8746806	+
GWHAAZE00000008	exon	8747266	8747346	+
GWHAAZE00000008	CDS	8742780	8742852	+
GWHAAZE00000008	CDS	8744615	8744687	+
GWHAAZE00000008	CDS	8745002	8745102	+
GWHAAZE00000008	CDS	8745488	8745553	+
GWHAAZE00000008	CDS	8745992	8746089	+
GWHAAZE00000008	CDS	8746570	8746632	+
GWHAAZE00000008	CDS	8746714	8746806	+
GWHAAZE00000008	CDS	8747266	8747346	+

Transcript Sequence
>GWHTAAZE026727 ATGGCTGCACCACCTGCTAGGGCTCGTGCGGATTATGATTACCTCATAAAGCTCCTTCTCATTGGCGACAGCGGTGTGGGTAAGAGTTGCCTGCTTTTGCGGTTCTCAGATGGTTCCTTTACAACAAGTTTTATTACCACTATTGGCATTGATTTCAAAATAAGAACTATTGAGCTTGACGGAAAGAGGATTAAGTTGCAAATCTGGGATACTGCGGGTCAGGAGCGGTTCCGTACTATCACAACAGCTTACTACCGAGGTGCCATGGGCATCTTGCTGGTGTATGATGTCACTGATGAATCGTCCTTCAACAACATCAGGAACTGGATTCGCAATATTGAACAACATGCCTCCGATAATGTCAACAAGATACTTGTGGGTAACAAGGCTGATATGGATGAAAGCAAAAGGGCTGTGCCAACCTCCAAGGGTCAAGCTCTTGCTGATGAATATGGCATCAAGTTCTTTGAAACTAGTGCAAAGACAAACATGAATGTGGAGGAGGTTTTCTTCTCGATAGCAAAAGATATAAAGCAAAGACTTGCAGAAACTGATTCAAGGGCTGAGCCCCAGACAATCAAGATGAATCAATCAGATCAAGCGGGAGGCAGTGATCAAGCTCCCCAAAAATCAAGTTGCTGTAACTAA

Network for GWHGAAZE026693

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00071.23	Ras	17	178	1.50E-66

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07901	RAB8A, MEL	AMPK signaling pathway	map04152
		Endocytosis	map04144
		Autophagy - animal	map04140
		Tight junction	map04530
		Pancreatic secretion	map04972

Gene Ontology

GO term	Ontology	Name
GO:0005525	molecular_function	GTP binding
GO:0003924	molecular_function	GTPase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	29.187
	SRR3591706	second leaf	17.844
	SRR3591707	mature leaf	14.792
	SRR3591708	Shoot apex	30.144
	SRR3591709	Stem	33.128
	SRR3591710	White floral bud	31.027
	SRR3591711	White flower	33.230
	SRR3591712	Green floral bud	50.216
	SRR3591713	Yellow flower	32.923
SRP173429	SRR8316895	Juvenile bud stage	22.446
	SRR8316896	Juvenile bud stage	38.627
	SRR8316897	Juvenile bud stage	19.455
	SRR8316894	Third green stage	14.769
	SRR8316900	Third green stage	48.343
	SRR8316901	Third green stage	48.223
	SRR8316898	Complete white stage	16.494
	SRR8316899	Complete white stage	36.707
	SRR8316903	Complete white stage	24.098
	SRR8316902	Silver flowering stage	14.582
	SRR8316904	Silver flowering stage	22.117
	SRR8316905	Silver flowering stage	10.440
	SRR8316906	Gold flowering stage	34.427
	SRR8316907	Gold flowering stage	27.564
	SRR8316908	Gold flowering stage	32.704
SRP132670	SRR6706286	Control	30.718
	SRR6706287	Light intensity 50%	29.092
	SRR6706288	Light intensity 20%	28.661
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	36.469
	CNS0095593	Slightly white alabastrum(diploid) 2	34.602
	CNS0095594	Slightly white alabastrum(diploid) 3	36.073
	CNS0095595	Whole white alabastrum(diploid) 2	44.618
	CNS0095596	Whole white alabastrum(diploid) 3	46.558
	CNS0095597	Whole white alabastrum(diploid) 4	41.707
	CNS0095598	Silvery flower (diploied) 1	23.631
	CNS0095599	Silvery flower (diploied) 2	19.958
	CNS0095600	Silvery flower (diploied) 3	35.488
	CNS0095601	Golden flower (diploid) 1	27.458
	CNS0095602	Golden flower (diploid) 2	33.184
	CNS0095603	Golden flower (diploid) 3	34.900
	CNS0095604	Slightly white alabastrum(tetraploid) 1	40.202
	CNS0095605	Slightly white alabastrum(tetraploid) 2	33.155
	CNS0095606	Slightly white alabastrum(tetraploid) 3	23.676
	CNS0095607	Whole white alabastrum(tetraploid) 1	42.301
	CNS0095608	Whole white alabastrum(tetraploid) 2	39.706
	CNS0095609	Whole white alabastrum(tetraploid) 3	37.815
	CNS0095610	Silvery flower (tetraploid) 1	29.798
	CNS0095611	Silvery flower (tetraploid) 2	26.270
	CNS0095612	Silvery flower (tetraploid) 3	23.535
	CNS0095613	Golden flower (tetraploid) 1	21.780
	CNS0095614	Golden flower (tetraploid) 2	27.677
	CNS0095615	Golden flower (tetraploid) 3	30.229
CRA001975	CRR073297	Stem 1	37.806
	CRR073298	Stem 2	40.330
	CRR073299	Stem 3	35.832
	CRR073300	Leaf 1	43.135
	CRR073301	Leaf 2	38.524
	CRR073302	Leaf 3	42.120
	CRR073303	Juvenile bud 1	46.626
	CRR073304	Juvenile bud 2	31.788
	CRR073305	Juvenile bud 3	27.047
	CRR073306	Third green 1	16.945
	CRR073307	Third green 2	20.229
	CRR073308	Third green 3	15.544
	CRR073309	Second white 1	14.745
	CRR073310	Second white 2	22.888
	CRR073311	Second white 3	16.278
	CRR073312	Silver flowering 1	15.093
	CRR073313	Silver flowering 2	16.787
	CRR073314	Silver flowering 3	25.708
	CRR073315	Gold flowering 1	12.790
	CRR073316	Gold flowering 2	8.916
	CRR073317	Gold flowering 3	8.087
	CRR073318	Tawny withering 1	36.003
	CRR073319	Tawny withering 2	29.047
	CRR073320	Tawny withering 3	33.986