Gene detail

Detail information of GWHGAAZE026698

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009762518.1	2.36706E-43	PREDICTED: zinc finger protein ZAT11-like [Nicotiana sylvestris]
Swissprot	tr\|Q9SLD4\|ZAT11_ARATH	3E-32	Zinc finger protein ZAT11
trEMBL	tr\|B9HTM6\|B9HTM6_POPTR	4E-43	Uncharacterized protein {ECO:0000313\|EMBL:EEF02476.2}
TAIR10	AT2G37430.1	1E-26	C2H2 and C2HC zinc fingers superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	8838350	8838709	-
GWHAAZE00000008	mRNA	8838350	8838709	-
GWHAAZE00000008	exon	8838350	8838709	-
GWHAAZE00000008	CDS	8838350	8838709	-

Transcript Sequence
>GWHTAAZE026732 ATGACAACAAATTCCCATACTCGAGTCTTCGAGTGCAAGACCTGTAACCGCCAGTTCACATCGTTCCAAGCCCTAGGTGGCCACCGGGCAAGCCACAAGAGGCCCCGGCTCACAGAAACCGACTTGAACCTGGGCAATCTGTCAGAGACCAAGCCCGTGACTAAGCCTAAATTGCACGAGTGCTCCATTTGTGGACTCGAGTTTGCGATAGGGCAAGCATTAGGGGGTCACATGAGGCGTCACAAAACTGGCTTGGGTGAGGTGGCTATGGGAAAAGTGCACAAAAGTAGAAGGGTTTTGTTCTTGGATTTGAACTTGACACCTTATGAGAATGATTTGAAGTTTGATTACTGTTTATGA

Network for GWHGAAZE026698

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13912.7	zf-C2H2_6	9	34	1.70E-12
PF13912.7	zf-C2H2_6	59	82	3.40E-09

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2H2

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003676	molecular_function	nucleic acid binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.395
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.304
	SRR3591711	White flower	0.304
	SRR3591712	Green floral bud	0.281
	SRR3591713	Yellow flower	8.025
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.432
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.090
	SRR8316901	Third green stage	0.009
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.144
	SRR8316903	Complete white stage	0.804
	SRR8316902	Silver flowering stage	0.203
	SRR8316904	Silver flowering stage	0.118
	SRR8316905	Silver flowering stage	0.095
	SRR8316906	Gold flowering stage	2.824
	SRR8316907	Gold flowering stage	0.884
	SRR8316908	Gold flowering stage	2.852
SRP132670	SRR6706286	Control	1.485
	SRR6706287	Light intensity 50%	0.311
	SRR6706288	Light intensity 20%	0.548
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.122
	CNS0095593	Slightly white alabastrum(diploid) 2	1.216
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.081
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.861
	CNS0095599	Silvery flower (diploied) 2	0.260
	CNS0095600	Silvery flower (diploied) 3	0.210
	CNS0095601	Golden flower (diploid) 1	0.612
	CNS0095602	Golden flower (diploid) 2	0.233
	CNS0095603	Golden flower (diploid) 3	1.028
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.080
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.377
	CNS0095611	Silvery flower (tetraploid) 2	0.411
	CNS0095612	Silvery flower (tetraploid) 3	0.667
	CNS0095613	Golden flower (tetraploid) 1	0.740
	CNS0095614	Golden flower (tetraploid) 2	1.684
	CNS0095615	Golden flower (tetraploid) 3	0.824
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.118
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.010
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.169
	CRR073307	Third green 2	1.799
	CRR073308	Third green 3	0.578
	CRR073309	Second white 1	0.425
	CRR073310	Second white 2	0.995
	CRR073311	Second white 3	0.354
	CRR073312	Silver flowering 1	0.071
	CRR073313	Silver flowering 2	0.507
	CRR073314	Silver flowering 3	3.009
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.146
	CRR073317	Gold flowering 3	0.117
	CRR073318	Tawny withering 1	10.513
	CRR073319	Tawny withering 2	10.150
	CRR073320	Tawny withering 3	1.665