Gene detail

Detail information of GWHGAAZE026775

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002510391.1	1.3798E-128	60S ribosomal protein L11, putative [Ricinus communis]
COG	YP_003435583.1	9E-51	50S ribosomal protein L5
Swissprot	tr\|P46287\|RL11_MEDSA	2E-129	60S ribosomal protein L11
trEMBL	tr\|B9R7U8\|B9R7U8_RICCO	5E-129	60S ribosomal protein L11, putative {ECO:0000313\|EMBL:EEF52578.1}
TAIR10	AT2G42740.1	2E-89	ribosomal protein large subunit 16A

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	9990778	9993130	-
GWHAAZE00000008	mRNA	9990778	9993130	-
GWHAAZE00000008	exon	9993128	9993130	-
GWHAAZE00000008	exon	9992674	9992781	-
GWHAAZE00000008	exon	9992544	9992586	-
GWHAAZE00000008	exon	9991639	9991834	-
GWHAAZE00000008	exon	9990778	9990976	-
GWHAAZE00000008	CDS	9993128	9993130	-
GWHAAZE00000008	CDS	9992674	9992781	-
GWHAAZE00000008	CDS	9992544	9992586	-
GWHAAZE00000008	CDS	9991639	9991834	-
GWHAAZE00000008	CDS	9990778	9990976	-

Transcript Sequence
>GWHTAAZE026809 ATGGCTTCAGAGAGGAAAATGTCGAACCCGATGAGGGAGATCAAAGTACAAAAGCTCGTCCTCAATATCTCCGTCGGCGAGAGTGGAGATCGACTCACCAGAGCTGCTAAGGTGTTGGAACAACTCAGTGGTCAAACCCCTGTTTTCTCCAAAGCGAGGTATACTGTGCGGTCCTTTGGGATCAGGCGTAATGAGAAGATTGCATGCTATGTTACCGTAAGGGGGGACAAGGCAATGCAGCTTCTGGAAAGCGGGTTGAAGGTGAAGGAATATGAGCTGTTGAGAAGGAACTTCAGTGATACTGGCTGTTTTGGCTTTGGTATTCAGGAGCACATTGATCTTGGAATCAAGTATGACCCGTCTACTGGGATATACGGTATGGATTTCTATGTGGTCCTGGAACGTCCCGGTTATCGTGTGGGCCGCCGTCGCAGGTGCAAGGCTCGTGTTGGAATCCAGCACAGGGTCACCAAGGATGATGCTATGAAGTGGTTCCAGGTCAAATATGAGGGTGTTATCCTTAACAAATCCCAGAATATAGGGGGCTAG

Network for GWHGAAZE026775

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00281.20	Ribosomal_L5	9	62	3.30E-21
PF00673.22	Ribosomal_L5_C	66	164	1.70E-20

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02868	RP-L11e, RPL11	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	128.275
	SRR3591706	second leaf	65.878
	SRR3591707	mature leaf	17.749
	SRR3591708	Shoot apex	231.878
	SRR3591709	Stem	60.604
	SRR3591710	White floral bud	43.645
	SRR3591711	White flower	48.638
	SRR3591712	Green floral bud	102.221
	SRR3591713	Yellow flower	27.028
SRP173429	SRR8316895	Juvenile bud stage	112.379
	SRR8316896	Juvenile bud stage	169.012
	SRR8316897	Juvenile bud stage	77.288
	SRR8316894	Third green stage	54.959
	SRR8316900	Third green stage	115.309
	SRR8316901	Third green stage	119.778
	SRR8316898	Complete white stage	15.269
	SRR8316899	Complete white stage	86.170
	SRR8316903	Complete white stage	25.260
	SRR8316902	Silver flowering stage	9.986
	SRR8316904	Silver flowering stage	11.214
	SRR8316905	Silver flowering stage	5.360
	SRR8316906	Gold flowering stage	17.833
	SRR8316907	Gold flowering stage	14.894
	SRR8316908	Gold flowering stage	22.569
SRP132670	SRR6706286	Control	113.477
	SRR6706287	Light intensity 50%	112.931
	SRR6706288	Light intensity 20%	121.646
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	187.386
	CNS0095593	Slightly white alabastrum(diploid) 2	166.395
	CNS0095594	Slightly white alabastrum(diploid) 3	186.382
	CNS0095595	Whole white alabastrum(diploid) 2	99.787
	CNS0095596	Whole white alabastrum(diploid) 3	130.769
	CNS0095597	Whole white alabastrum(diploid) 4	84.881
	CNS0095598	Silvery flower (diploied) 1	78.052
	CNS0095599	Silvery flower (diploied) 2	68.297
	CNS0095600	Silvery flower (diploied) 3	32.580
	CNS0095601	Golden flower (diploid) 1	60.165
	CNS0095602	Golden flower (diploid) 2	33.791
	CNS0095603	Golden flower (diploid) 3	35.263
	CNS0095604	Slightly white alabastrum(tetraploid) 1	159.193
	CNS0095605	Slightly white alabastrum(tetraploid) 2	175.449
	CNS0095606	Slightly white alabastrum(tetraploid) 3	141.308
	CNS0095607	Whole white alabastrum(tetraploid) 1	80.841
	CNS0095608	Whole white alabastrum(tetraploid) 2	62.423
	CNS0095609	Whole white alabastrum(tetraploid) 3	109.601
	CNS0095610	Silvery flower (tetraploid) 1	20.852
	CNS0095611	Silvery flower (tetraploid) 2	25.911
	CNS0095612	Silvery flower (tetraploid) 3	12.096
	CNS0095613	Golden flower (tetraploid) 1	11.655
	CNS0095614	Golden flower (tetraploid) 2	19.813
	CNS0095615	Golden flower (tetraploid) 3	8.380
CRA001975	CRR073297	Stem 1	161.751
	CRR073298	Stem 2	146.615
	CRR073299	Stem 3	165.796
	CRR073300	Leaf 1	119.586
	CRR073301	Leaf 2	137.639
	CRR073302	Leaf 3	169.926
	CRR073303	Juvenile bud 1	82.857
	CRR073304	Juvenile bud 2	55.388
	CRR073305	Juvenile bud 3	69.218
	CRR073306	Third green 1	5.705
	CRR073307	Third green 2	5.140
	CRR073308	Third green 3	7.976
	CRR073309	Second white 1	6.528
	CRR073310	Second white 2	6.746
	CRR073311	Second white 3	4.696
	CRR073312	Silver flowering 1	5.980
	CRR073313	Silver flowering 2	4.571
	CRR073314	Silver flowering 3	4.863
	CRR073315	Gold flowering 1	47.008
	CRR073316	Gold flowering 2	49.955
	CRR073317	Gold flowering 3	47.772
	CRR073318	Tawny withering 1	109.891
	CRR073319	Tawny withering 2	86.623
	CRR073320	Tawny withering 3	102.415