Gene detail

Detail information of GWHGAAZE026829

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009780941.1	1.03426E-72	PREDICTED: trans-resveratrol di-O-methyltransferase-like [Nicotiana sylvestris]
Swissprot	tr\|B6VJS4\|ROMT_VITVI	7E-66	Trans-resveratrol di-O-methyltransferase
trEMBL	tr\|F6H5F7\|F6H5F7_VITVI	6E-71	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB47319.1}
TAIR10	AT4G35160.1	4E-16	O-methyltransferase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	10691469	10692044	+
GWHAAZE00000008	mRNA	10691469	10692044	+
GWHAAZE00000008	exon	10691469	10692044	+
GWHAAZE00000008	CDS	10691469	10692044	+

Transcript Sequence
>GWHTAAZE026863 ATGGAGCTAATCAACAAAGGAAAGAAATCTAGTGCTATTAGTAGCGAGCTACTTCAATCCCAAGCTCACATATGGAACCACCTATTCAACTTCATAAACTCCATGTCACTCAAGTGTGCTATCCAACTAAACATACCCGATATCATCCATACCCATGCCCGACCCATGACCCTCTCTCACCTCCTCCAAGCTCTAGCCATCAACACATCTAAAGCCACCCATATCTACCGGCTCATGCGCATTCTCACTCACTCCGGCTTCTTTACTATATCCAAAATTCAAGAATCCGGAGAAGAAAATCAAGAAGAAGGATATCTGTTGACGCCAGCTTGTCGGCTCCTACTAAAGGACGAATCGACGAGCGTGACGCCATTCCTTCTAGCTATTCTCGACCCGGCTCTGGCAGACCCGTGGCATTGTATGAGCCGTTGGTTTGAGAATGAGGATAAAAATGCGTTTGAGACGTTCCACGGAAGGACCTTGTGGGACCATATGGGGAGTGATGAGAGGCTTTGTTGTTTGTTTAATGATGCTATGGCTAGTGATGCTGCCTTGATAGGTCGGGTGGATGGTTAA

Network for GWHGAAZE026829

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF08100.12	Dimerisation	35	83	1.30E-16

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K16040	ROMT	Stilbenoid, diarylheptanoid and gingerol biosynthesis	map00945

Gene Ontology

GO term	Ontology	Name
GO:0046983	molecular_function	protein dimerization activity
GO:0008168	molecular_function	methyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.164
	SRR3591706	second leaf	0.571
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	2.579
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	1.088
	SRR3591711	White flower	0.151
	SRR3591712	Green floral bud	0.682
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	9.415
	SRR8316896	Juvenile bud stage	4.903
	SRR8316897	Juvenile bud stage	2.175
	SRR8316894	Third green stage	1.118
	SRR8316900	Third green stage	1.193
	SRR8316901	Third green stage	1.421
	SRR8316898	Complete white stage	0.808
	SRR8316899	Complete white stage	0.198
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.362
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.119
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	2.161
	SRR6706287	Light intensity 50%	3.519
	SRR6706288	Light intensity 20%	3.678
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	7.382
	CNS0095593	Slightly white alabastrum(diploid) 2	3.127
	CNS0095594	Slightly white alabastrum(diploid) 3	4.441
	CNS0095595	Whole white alabastrum(diploid) 2	1.516
	CNS0095596	Whole white alabastrum(diploid) 3	2.399
	CNS0095597	Whole white alabastrum(diploid) 4	1.551
	CNS0095598	Silvery flower (diploied) 1	0.056
	CNS0095599	Silvery flower (diploied) 2	0.808
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.820
	CNS0095602	Golden flower (diploid) 2	0.096
	CNS0095603	Golden flower (diploid) 3	0.080
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.938
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.885
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.093
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.837
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.185
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.381
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.135
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	9.278
	CRR073298	Stem 2	6.081
	CRR073299	Stem 3	6.681
	CRR073300	Leaf 1	2.754
	CRR073301	Leaf 2	3.103
	CRR073302	Leaf 3	2.181
	CRR073303	Juvenile bud 1	1.667
	CRR073304	Juvenile bud 2	3.990
	CRR073305	Juvenile bud 3	1.964
	CRR073306	Third green 1	4.280
	CRR073307	Third green 2	0.287
	CRR073308	Third green 3	1.912
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000