Gene detail

Detail information of GWHGAAZE026830

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI21924.3	5.96417E-75	unnamed protein product [Vitis vinifera]
COG	YP_006433319.1	1E-21	methylase involved in ubiquinone/menaquinone biosynthesis
Swissprot	tr\|B6VJS4\|ROMT_VITVI	1E-70	Trans-resveratrol di-O-methyltransferase
trEMBL	tr\|A5BZY9\|A5BZY9_VITVI	1E-72	Putative uncharacterized protein {ECO:0000313\|EMBL:CAN61955.1}
TAIR10	AT1G51990.1	5E-26	O-methyltransferase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	10692106	10694682	+
GWHAAZE00000008	mRNA	10692106	10694682	+
GWHAAZE00000008	exon	10692106	10692264	+
GWHAAZE00000008	exon	10694383	10694682	+
GWHAAZE00000008	CDS	10692106	10692264	+
GWHAAZE00000008	CDS	10694383	10694682	+

Transcript Sequence
>GWHTAAZE026864 ATGATGGCCAAGACCGTCGCAGGTGCTCTCCCAGAGGTGAAGTGGACGGTGCTTGACCTGCCGCAGGTGGTGGCGGGACTTGAAGGTGGTAAGAATTTGAGGTTTGTTAGTGGGGACATGTTTGAGTCAATTCCCAATGCCGATGCAGTTCTACTAAAGTGGATATTGCATGATTGGAACGATGAAGATTGTGTAAAAATACTGAAGAAATGCAGAGAAGCAATCCCTAGCAAGGATGAGGGAGGAAAGGTGATTATCATAGAGATGATTGTTGATAACCGTAACCCGGATAAGGATTCAATCGAAAACCAGTTCTTCTTCGATATGTTAATGATGGTTTTGGCGACGGGAAGAGAAAGGAACGAGAAAGAATGGGAGAAGCTTTTCCTTGATGCTGGCTTTAGTGAGCATAAGATAACTCCTTTGGGTTTGAGATCTCTAATTGAGGTTTATCCTTGA

Network for GWHGAAZE026830

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00891.19	Methyltransf_2	2	135	8.90E-40

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K16040	ROMT	Stilbenoid, diarylheptanoid and gingerol biosynthesis	map00945

Gene Ontology

GO term	Ontology	Name
GO:0008168	molecular_function	methyltransferase activity
GO:0008171	molecular_function	O-methyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.520
	SRR3591706	second leaf	0.538
	SRR3591707	mature leaf	0.360
	SRR3591708	Shoot apex	5.722
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.429
	SRR3591711	White flower	0.325
	SRR3591712	Green floral bud	0.363
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	9.978
	SRR8316896	Juvenile bud stage	7.253
	SRR8316897	Juvenile bud stage	4.093
	SRR8316894	Third green stage	0.959
	SRR8316900	Third green stage	1.937
	SRR8316901	Third green stage	1.636
	SRR8316898	Complete white stage	0.902
	SRR8316899	Complete white stage	1.657
	SRR8316903	Complete white stage	0.112
	SRR8316902	Silver flowering stage	0.097
	SRR8316904	Silver flowering stage	0.150
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.090
	SRR8316907	Gold flowering stage	0.306
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.624
	SRR6706287	Light intensity 50%	1.141
	SRR6706288	Light intensity 20%	1.647
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.507
	CNS0095593	Slightly white alabastrum(diploid) 2	11.727
	CNS0095594	Slightly white alabastrum(diploid) 3	12.840
	CNS0095595	Whole white alabastrum(diploid) 2	6.357
	CNS0095596	Whole white alabastrum(diploid) 3	7.977
	CNS0095597	Whole white alabastrum(diploid) 4	4.271
	CNS0095598	Silvery flower (diploied) 1	0.112
	CNS0095599	Silvery flower (diploied) 2	0.336
	CNS0095600	Silvery flower (diploied) 3	0.283
	CNS0095601	Golden flower (diploid) 1	0.445
	CNS0095602	Golden flower (diploid) 2	0.267
	CNS0095603	Golden flower (diploid) 3	0.079
	CNS0095604	Slightly white alabastrum(tetraploid) 1	7.565
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.809
	CNS0095606	Slightly white alabastrum(tetraploid) 3	12.870
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.752
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.834
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.813
	CNS0095610	Silvery flower (tetraploid) 1	0.278
	CNS0095611	Silvery flower (tetraploid) 2	0.091
	CNS0095612	Silvery flower (tetraploid) 3	0.005
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	3.469
	CRR073298	Stem 2	3.163
	CRR073299	Stem 3	3.883
	CRR073300	Leaf 1	2.476
	CRR073301	Leaf 2	1.289
	CRR073302	Leaf 3	1.757
	CRR073303	Juvenile bud 1	0.269
	CRR073304	Juvenile bud 2	2.974
	CRR073305	Juvenile bud 3	1.089
	CRR073306	Third green 1	1.211
	CRR073307	Third green 2	0.269
	CRR073308	Third green 3	1.417
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.071
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.095
	CRR073320	Tawny withering 3	0.206