Gene detail

Detail information of GWHGAAZE026993

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008448627.1	3.9201E-110	PREDICTED: vacuolar protein sorting-associated protein 25 isoform X1 [Cucumis melo]
Swissprot	tr\|Q8VZC9\|VPS25_ARATH	2E-104	Vacuolar protein sorting-associated protein 25
trEMBL	tr\|A0A0A0L1R7\|A0A0A0L1R7_CUCSA	3E-110	Uncharacterized protein {ECO:0000313\|EMBL:KGN55713.1}
TAIR10	AT4G19003.2	1E-82	E2F/DP family winged-helix DNA-binding domain

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	13310732	13314028	-
GWHAAZE00000008	mRNA	13310732	13314028	-
GWHAAZE00000008	exon	13313970	13314028	-
GWHAAZE00000008	exon	13313027	13313223	-
GWHAAZE00000008	exon	13311598	13311651	-
GWHAAZE00000008	exon	13311415	13311503	-
GWHAAZE00000008	exon	13311266	13311341	-
GWHAAZE00000008	exon	13310732	13310853	-
GWHAAZE00000008	CDS	13313970	13314028	-
GWHAAZE00000008	CDS	13313027	13313223	-
GWHAAZE00000008	CDS	13311598	13311651	-
GWHAAZE00000008	CDS	13311415	13311503	-
GWHAAZE00000008	CDS	13311266	13311341	-
GWHAAZE00000008	CDS	13310732	13310853	-

Transcript Sequence
>GWHTAAZE027027 ATGCAGAAGTTGGGTGATTTCAAGCTTCCTCACTTCTTCAATTATCCACCATACTTCACATTTAGAAATAGAAATTTAGGATTCATTTCGTCACATTCTGGTTTTTTTGTCTTCAGTTTGCAGCCTGTAAGAGACACTCGAGAGAAACAGGTACAACTGTGGAAGGAACTGATACTTGATTATTGTAAAACTCAAAAGATATTTGTTATTCAATTGGAAGACGACTTTCCACTGTTCACCAATCCTGCAATTGAAAGGTCTCTTAGTCACGAAGCAAGGGCCGCGTTCCTCTCAGCCTTAGTTTTAGATGGACGTGCTGAATGGATGGACAAAAGTCGTAGAAAATGTCTTGTCCTTTGGCATCGGATTCAAGATTGGGCGGACTTGATTTTACACTTTGTGAAGGAGAATGGATTGGAGGACAGCGTGATGACGGTTGAGGAAATACGCACTGGCATTGAATCCCGAGGAACAGACCTTCACGGGATGGACCGGACAGTACTAATGCGAGCCCTCAAGTTACTAGAACAGAAAGGGAAGCTTGCTGTCTTCAAGGGAACTTCGGCCGATGATGAAGGCATTAAATTCTCTGTATAG

Network for GWHGAAZE026993

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05871.13	ESCRT-II	13	164	1.50E-39

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12189	VPS25, EAP20	Endocytosis	map04144

Gene Ontology

GO term	Ontology	Name
GO:0071985	biological_process	multivesicular body sorting pathway
GO:0000814	cellular_component	ESCRT II complex

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	52.507
	SRR3591706	second leaf	29.307
	SRR3591707	mature leaf	30.166
	SRR3591708	Shoot apex	49.389
	SRR3591709	Stem	54.457
	SRR3591710	White floral bud	46.311
	SRR3591711	White flower	51.237
	SRR3591712	Green floral bud	44.731
	SRR3591713	Yellow flower	66.634
SRP173429	SRR8316895	Juvenile bud stage	31.231
	SRR8316896	Juvenile bud stage	46.669
	SRR8316897	Juvenile bud stage	24.113
	SRR8316894	Third green stage	16.136
	SRR8316900	Third green stage	45.386
	SRR8316901	Third green stage	42.660
	SRR8316898	Complete white stage	23.554
	SRR8316899	Complete white stage	55.716
	SRR8316903	Complete white stage	31.946
	SRR8316902	Silver flowering stage	27.234
	SRR8316904	Silver flowering stage	31.990
	SRR8316905	Silver flowering stage	14.445
	SRR8316906	Gold flowering stage	48.832
	SRR8316907	Gold flowering stage	48.994
	SRR8316908	Gold flowering stage	40.995
SRP132670	SRR6706286	Control	23.135
	SRR6706287	Light intensity 50%	29.739
	SRR6706288	Light intensity 20%	27.499
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	61.054
	CNS0095593	Slightly white alabastrum(diploid) 2	56.320
	CNS0095594	Slightly white alabastrum(diploid) 3	50.646
	CNS0095595	Whole white alabastrum(diploid) 2	44.944
	CNS0095596	Whole white alabastrum(diploid) 3	44.795
	CNS0095597	Whole white alabastrum(diploid) 4	46.634
	CNS0095598	Silvery flower (diploied) 1	65.709
	CNS0095599	Silvery flower (diploied) 2	55.140
	CNS0095600	Silvery flower (diploied) 3	42.983
	CNS0095601	Golden flower (diploid) 1	57.426
	CNS0095602	Golden flower (diploid) 2	47.752
	CNS0095603	Golden flower (diploid) 3	45.259
	CNS0095604	Slightly white alabastrum(tetraploid) 1	51.162
	CNS0095605	Slightly white alabastrum(tetraploid) 2	42.113
	CNS0095606	Slightly white alabastrum(tetraploid) 3	52.570
	CNS0095607	Whole white alabastrum(tetraploid) 1	39.412
	CNS0095608	Whole white alabastrum(tetraploid) 2	34.831
	CNS0095609	Whole white alabastrum(tetraploid) 3	35.794
	CNS0095610	Silvery flower (tetraploid) 1	59.166
	CNS0095611	Silvery flower (tetraploid) 2	49.428
	CNS0095612	Silvery flower (tetraploid) 3	43.131
	CNS0095613	Golden flower (tetraploid) 1	63.502
	CNS0095614	Golden flower (tetraploid) 2	52.921
	CNS0095615	Golden flower (tetraploid) 3	49.375
CRA001975	CRR073297	Stem 1	42.856
	CRR073298	Stem 2	39.083
	CRR073299	Stem 3	35.392
	CRR073300	Leaf 1	41.935
	CRR073301	Leaf 2	37.889
	CRR073302	Leaf 3	28.610
	CRR073303	Juvenile bud 1	39.695
	CRR073304	Juvenile bud 2	26.832
	CRR073305	Juvenile bud 3	27.439
	CRR073306	Third green 1	20.923
	CRR073307	Third green 2	23.635
	CRR073308	Third green 3	22.517
	CRR073309	Second white 1	20.818
	CRR073310	Second white 2	20.200
	CRR073311	Second white 3	20.487
	CRR073312	Silver flowering 1	21.359
	CRR073313	Silver flowering 2	12.189
	CRR073314	Silver flowering 3	15.723
	CRR073315	Gold flowering 1	21.614
	CRR073316	Gold flowering 2	26.589
	CRR073317	Gold flowering 3	14.818
	CRR073318	Tawny withering 1	41.582
	CRR073319	Tawny withering 2	44.986
	CRR073320	Tawny withering 3	42.164