Gene detail

Detail information of GWHGAAZE027049

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002264437.1	2.40371E-56	PREDICTED: probable glutathione S-transferase [Vitis vinifera]
COG	YP_007142062.1	1E-13	glutathione S-transferase
Swissprot	tr\|Q03666\|GSTX4_TOBAC	8E-55	Probable glutathione S-transferase
trEMBL	tr\|F6HR78\|F6HR78_VITVI	9E-57	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB57186.1}
TAIR10	AT1G78320.1	1E-42	glutathione S-transferase TAU 23

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	14061866	14062192	+
GWHAAZE00000008	mRNA	14061866	14062192	+
GWHAAZE00000008	exon	14061866	14062192	+
GWHAAZE00000008	CDS	14061866	14062192	+

Transcript Sequence
>GWHTAAZE027083 ATGGGAGGGAGTGAGTTGATTTTGTTAGACTTTTGGGCAAGTATGTTTGGGATGAGGGTGAGGATTGCTCTTGTAGAGAAAGGTATTGAGTATGAGTTCAAAGAAGAGGACTTGGTTAATAACAGAAGCCCATTCCTATCGAAGATGAACCCGGTTCACAAGAAAATTCCGGTTCTCATTCACAATGGGAAACCGGTTTGTGAGTCACTCATTGCGGTCCAGTACATAGATGAGGTGTGGAAGGATAAAGCTCCATTGTTGCCCTCTGATCCTTACCAGAGAGCTCAAGCTAGGTTTTGGGCTGACTTTATTCACAAGAAGGTATAA

Network for GWHGAAZE027049

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02798.21	GST_N	5	78	3.70E-18

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00799	GST, gst	Metabolic pathways	map01100
		Glutathione metabolism	map00480
		Metabolism of xenobiotics by cytochrome P450	map00980
		Drug metabolism - cytochrome P450	map00982
		Drug metabolism - other enzymes	map00983
		Longevity regulating pathway - worm	map04212

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.536
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	1.151
	SRR3591710	White floral bud	0.331
	SRR3591711	White flower	0.294
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.019
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.131
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.018
	SRR8316901	Third green stage	0.030
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.652
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.030
	SRR8316905	Silver flowering stage	0.104
	SRR8316906	Gold flowering stage	0.083
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.014
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.128
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.013
	CNS0095602	Golden flower (diploid) 2	0.210
	CNS0095603	Golden flower (diploid) 3	0.026
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.230
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.033
	CNS0095613	Golden flower (tetraploid) 1	0.192
	CNS0095614	Golden flower (tetraploid) 2	0.139
	CNS0095615	Golden flower (tetraploid) 3	0.179
CRA001975	CRR073297	Stem 1	0.150
	CRR073298	Stem 2	0.155
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.024
	CRR073303	Juvenile bud 1	0.029
	CRR073304	Juvenile bud 2	0.028
	CRR073305	Juvenile bud 3	0.089
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.020
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.506
	CRR073310	Second white 2	0.237
	CRR073311	Second white 3	0.131
	CRR073312	Silver flowering 1	0.188
	CRR073313	Silver flowering 2	0.603
	CRR073314	Silver flowering 3	0.719
	CRR073315	Gold flowering 1	0.238
	CRR073316	Gold flowering 2	0.238
	CRR073317	Gold flowering 3	0.266
	CRR073318	Tawny withering 1	0.549
	CRR073319	Tawny withering 2	0.408
	CRR073320	Tawny withering 3	0.104