Gene detail

Detail information of GWHGAAZE027184

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KHG07627.1	1.75771E-79	Beta-glucosidase 18 [Gossypium arboreum]
COG	YP_004449345.1	4E-28	beta-galactosidase
Swissprot	tr\|Q7XSK0\|BGL18_ORYSJ	8E-59	Beta-glucosidase 18 (Precursor)
trEMBL	tr\|U5GVY1\|U5GVY1_POPTR	4E-78	Uncharacterized protein {ECO:0000313\|EMBL:ERP66871.1}
TAIR10	AT1G61810.3	3E-49	beta-glucosidase 45

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	15856559	15857476	-
GWHAAZE00000008	mRNA	15856559	15857476	-
GWHAAZE00000008	exon	15857395	15857476	-
GWHAAZE00000008	exon	15857133	15857220	-
GWHAAZE00000008	exon	15856559	15856898	-
GWHAAZE00000008	CDS	15857395	15857476	-
GWHAAZE00000008	CDS	15857133	15857220	-
GWHAAZE00000008	CDS	15856559	15856898	-

Transcript Sequence
>GWHTAAZE027218 GTACCAGGAGGAAGATTTGGTGAAGTCAATCCAGCTGGGGTCCTGTTCTATAACAAAATTATTGACAATCTCTTACACAAAGGAATTGAGCCATTTGTGACCATTCATCATCATGACTTCCCCCAAGAACTAGAGGATAGATATGGAGCCTGGCTTAGTCCCCTGATGCAAGAAGATTTTGTTCATTTCGCAGAAATCTGTTTCAAGAGCTTTGGTGATCGAGTCAAGTACTGGACTAGCATAAACGAACCCAACCTTTTTGCAAACATGGCTTATTTGTTTGGCCAGTACCCGCCTGCTCATTGTTCCATACCTTTCGGCAACTGCTCCGCTGGCAATTCCGACGTGGAACCTCTCACGGCTATGCACAACATGTTACTGGCACATGCCAAGGCCACCAAGCTATATCGCGAGCATTTTCAGGCAATTACCTCCTCTCTTCAGTCCATAAAGATTTTTTTTCTTTTTAATTTAATTTACTTGATCCTCACCAAATTTGAAATTAATTAA

Network for GWHGAAZE027184

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00232.19	Glyco_hydro_1	2	142	2.80E-42

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05350	bglB	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Starch and sucrose metabolism	map00500
		Cyanoamino acid metabolism	map00460
		Phenylpropanoid biosynthesis	map00940

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0004553	molecular_function	hydrolase activity, hydrolyzing O-glycosyl compounds

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	153.094
	SRR3591706	second leaf	38.094
	SRR3591707	mature leaf	26.857
	SRR3591708	Shoot apex	45.472
	SRR3591709	Stem	162.004
	SRR3591710	White floral bud	49.153
	SRR3591711	White flower	66.483
	SRR3591712	Green floral bud	35.882
	SRR3591713	Yellow flower	126.855
SRP173429	SRR8316895	Juvenile bud stage	33.999
	SRR8316896	Juvenile bud stage	22.280
	SRR8316897	Juvenile bud stage	8.829
	SRR8316894	Third green stage	14.032
	SRR8316900	Third green stage	56.551
	SRR8316901	Third green stage	48.788
	SRR8316898	Complete white stage	21.138
	SRR8316899	Complete white stage	93.542
	SRR8316903	Complete white stage	37.976
	SRR8316902	Silver flowering stage	8.613
	SRR8316904	Silver flowering stage	19.410
	SRR8316905	Silver flowering stage	6.553
	SRR8316906	Gold flowering stage	39.625
	SRR8316907	Gold flowering stage	53.105
	SRR8316908	Gold flowering stage	73.655
SRP132670	SRR6706286	Control	77.664
	SRR6706287	Light intensity 50%	81.043
	SRR6706288	Light intensity 20%	73.604
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	16.135
	CNS0095593	Slightly white alabastrum(diploid) 2	17.086
	CNS0095594	Slightly white alabastrum(diploid) 3	18.115
	CNS0095595	Whole white alabastrum(diploid) 2	16.780
	CNS0095596	Whole white alabastrum(diploid) 3	19.868
	CNS0095597	Whole white alabastrum(diploid) 4	23.848
	CNS0095598	Silvery flower (diploied) 1	52.844
	CNS0095599	Silvery flower (diploied) 2	29.431
	CNS0095600	Silvery flower (diploied) 3	33.800
	CNS0095601	Golden flower (diploid) 1	33.330
	CNS0095602	Golden flower (diploid) 2	65.792
	CNS0095603	Golden flower (diploid) 3	67.356
	CNS0095604	Slightly white alabastrum(tetraploid) 1	21.632
	CNS0095605	Slightly white alabastrum(tetraploid) 2	18.050
	CNS0095606	Slightly white alabastrum(tetraploid) 3	46.867
	CNS0095607	Whole white alabastrum(tetraploid) 1	20.513
	CNS0095608	Whole white alabastrum(tetraploid) 2	10.972
	CNS0095609	Whole white alabastrum(tetraploid) 3	34.293
	CNS0095610	Silvery flower (tetraploid) 1	80.269
	CNS0095611	Silvery flower (tetraploid) 2	49.022
	CNS0095612	Silvery flower (tetraploid) 3	27.491
	CNS0095613	Golden flower (tetraploid) 1	40.749
	CNS0095614	Golden flower (tetraploid) 2	42.220
	CNS0095615	Golden flower (tetraploid) 3	47.819
CRA001975	CRR073297	Stem 1	68.006
	CRR073298	Stem 2	41.617
	CRR073299	Stem 3	29.199
	CRR073300	Leaf 1	61.680
	CRR073301	Leaf 2	62.453
	CRR073302	Leaf 3	37.329
	CRR073303	Juvenile bud 1	54.834
	CRR073304	Juvenile bud 2	46.934
	CRR073305	Juvenile bud 3	54.424
	CRR073306	Third green 1	20.418
	CRR073307	Third green 2	21.944
	CRR073308	Third green 3	21.327
	CRR073309	Second white 1	7.865
	CRR073310	Second white 2	10.548
	CRR073311	Second white 3	5.853
	CRR073312	Silver flowering 1	19.034
	CRR073313	Silver flowering 2	18.634
	CRR073314	Silver flowering 3	23.430
	CRR073315	Gold flowering 1	7.503
	CRR073316	Gold flowering 2	13.753
	CRR073317	Gold flowering 3	7.265
	CRR073318	Tawny withering 1	42.671
	CRR073319	Tawny withering 2	32.754
	CRR073320	Tawny withering 3	31.565