Gene detail

Detail information of GWHGAAZE027203

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002284361.1	6.4859E-123	PREDICTED: cytochrome b6-f complex iron-sulfur subunit 1, chloroplastic [Vitis vinifera]
COG	YP_007114877.1	4E-76	Cytochrome b6-f complex iron-sulfur subunit
Swissprot	tr\|P26291\|UCRIA_PEA	2E-115	Cytochrome b6-f complex iron-sulfur subunit, chloroplastic (Precursor)
trEMBL	tr\|A5BX41\|A5BX41_VITVI	2E-123	Cytochrome b6-f complex iron-sulfur subunit {ECO:0000256\|RuleBase:RU004496}
TAIR10	AT4G03280.1	2E-79	photosynthetic electron transfer C

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	16159206	16161411	+
GWHAAZE00000008	mRNA	16159206	16161411	+
GWHAAZE00000008	exon	16159206	16159244	+
GWHAAZE00000008	exon	16159345	16159595	+
GWHAAZE00000008	exon	16160370	16160487	+
GWHAAZE00000008	exon	16160677	16160742	+
GWHAAZE00000008	exon	16160920	16161102	+
GWHAAZE00000008	exon	16161304	16161411	+
GWHAAZE00000008	CDS	16159206	16159244	+
GWHAAZE00000008	CDS	16159345	16159595	+
GWHAAZE00000008	CDS	16160370	16160487	+
GWHAAZE00000008	CDS	16160677	16160742	+
GWHAAZE00000008	CDS	16160920	16161102	+
GWHAAZE00000008	CDS	16161304	16161411	+

Transcript Sequence
>GWHTAAZE027237 ATGGCTGCCTCTACACTCTCCCCTGTATCCCCTTCTCAGCTTTGTTCCATTAGTAAGAATGGGATGTCCGGTGCATCATCGATGGTAAAGTCGACTACGAGAACCTCCCAATTGGGGGGAGGAATGGGGAAGAAGAGCGCGAAGATCACGTGCCAGGCGACGAGCATACCTGCGGATCGGGTGCCAGACATGGGGAAGAGAGAGCTCATGAATTTGCTTCTCTTGGGTGCTCTTTCCCTTCCCACAGCCGGCATGTTGATCCCTTACGGCTCCTTTTTGGCTCCACCTGGTTCGGGAGCTGGTAGTGCTGGTACTCCGGCAAAGGATGCACTTGGAAATGACGTCATTGCATCCGAGTGGCTAAAGACCCATGGACCTGGTGACCGAACCCTTACTCAGGGCTTGAAGCGAATGGTTCATTGTAAATCTAGTTACCACTATACTTCAAGGGTACCTGTTGACCTTACTGCAAAGGGAGATCCGACGTACCTTGTGGTGGAGAACGACAAAACTCTAGCAACCTATGGTATTAACGCAGTTTGCACACATCTTGGGTGCGTTGTACCGTTTAATAAAGCAGAGAACAAGTTCCTTTGCCCGTGCCATGGATCTCAGTACAACAACCAAGGCAGAGTTGTTAGAGGTCCTGCTCCTCTGTCGTTAGCGCTTGCGCATGCAGATGTTGATGTTGATGAAGGGAAAGTTTTGTTTGTTCCATGGGTTGAAACGGACTTCAGGACAGGCGAAGCTCCATGGTGGTCTTAA

Network for GWHGAAZE027203

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00355.27	Rieske	152	221	4.10E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02636	petC	Metabolic pathways	map01100
K02636	petC	Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016020	cellular_component	membrane
GO:0042651	cellular_component	thylakoid membrane
GO:0016491	molecular_function	oxidoreductase activity
GO:0051537	molecular_function	2 iron, 2 sulfur cluster binding
GO:0009496	molecular_function	plastoquinol--plastocyanin reductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	459.519
	SRR3591706	second leaf	2651.101
	SRR3591707	mature leaf	2613.679
	SRR3591708	Shoot apex	870.650
	SRR3591709	Stem	273.666
	SRR3591710	White floral bud	239.698
	SRR3591711	White flower	167.950
	SRR3591712	Green floral bud	267.131
	SRR3591713	Yellow flower	137.471
SRP173429	SRR8316895	Juvenile bud stage	371.183
	SRR8316896	Juvenile bud stage	364.687
	SRR8316897	Juvenile bud stage	243.749
	SRR8316894	Third green stage	146.996
	SRR8316900	Third green stage	438.541
	SRR8316901	Third green stage	438.706
	SRR8316898	Complete white stage	207.396
	SRR8316899	Complete white stage	485.157
	SRR8316903	Complete white stage	246.743
	SRR8316902	Silver flowering stage	133.581
	SRR8316904	Silver flowering stage	118.284
	SRR8316905	Silver flowering stage	87.876
	SRR8316906	Gold flowering stage	197.010
	SRR8316907	Gold flowering stage	191.353
	SRR8316908	Gold flowering stage	210.554
SRP132670	SRR6706286	Control	313.949
	SRR6706287	Light intensity 50%	301.101
	SRR6706288	Light intensity 20%	323.912
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	292.489
	CNS0095593	Slightly white alabastrum(diploid) 2	250.233
	CNS0095594	Slightly white alabastrum(diploid) 3	240.688
	CNS0095595	Whole white alabastrum(diploid) 2	236.386
	CNS0095596	Whole white alabastrum(diploid) 3	288.444
	CNS0095597	Whole white alabastrum(diploid) 4	208.460
	CNS0095598	Silvery flower (diploied) 1	286.025
	CNS0095599	Silvery flower (diploied) 2	295.942
	CNS0095600	Silvery flower (diploied) 3	205.612
	CNS0095601	Golden flower (diploid) 1	288.880
	CNS0095602	Golden flower (diploid) 2	209.265
	CNS0095603	Golden flower (diploid) 3	209.348
	CNS0095604	Slightly white alabastrum(tetraploid) 1	259.153
	CNS0095605	Slightly white alabastrum(tetraploid) 2	279.715
	CNS0095606	Slightly white alabastrum(tetraploid) 3	333.780
	CNS0095607	Whole white alabastrum(tetraploid) 1	146.382
	CNS0095608	Whole white alabastrum(tetraploid) 2	204.194
	CNS0095609	Whole white alabastrum(tetraploid) 3	310.163
	CNS0095610	Silvery flower (tetraploid) 1	169.270
	CNS0095611	Silvery flower (tetraploid) 2	233.781
	CNS0095612	Silvery flower (tetraploid) 3	197.790
	CNS0095613	Golden flower (tetraploid) 1	108.296
	CNS0095614	Golden flower (tetraploid) 2	128.554
	CNS0095615	Golden flower (tetraploid) 3	114.709
CRA001975	CRR073297	Stem 1	554.903
	CRR073298	Stem 2	483.734
	CRR073299	Stem 3	593.154
	CRR073300	Leaf 1	359.769
	CRR073301	Leaf 2	418.411
	CRR073302	Leaf 3	410.256
	CRR073303	Juvenile bud 1	484.110
	CRR073304	Juvenile bud 2	530.468
	CRR073305	Juvenile bud 3	379.912
	CRR073306	Third green 1	347.480
	CRR073307	Third green 2	265.399
	CRR073308	Third green 3	247.240
	CRR073309	Second white 1	160.394
	CRR073310	Second white 2	164.514
	CRR073311	Second white 3	102.425
	CRR073312	Silver flowering 1	99.818
	CRR073313	Silver flowering 2	115.885
	CRR073314	Silver flowering 3	101.693
	CRR073315	Gold flowering 1	4017.732
	CRR073316	Gold flowering 2	3939.376
	CRR073317	Gold flowering 3	3010.545
	CRR073318	Tawny withering 1	279.789
	CRR073319	Tawny withering 2	352.204
	CRR073320	Tawny withering 3	234.184